Incidental Mutation 'R7463:Dnai2'
ID 578577
Institutional Source Beutler Lab
Gene Symbol Dnai2
Ensembl Gene ENSMUSG00000034706
Gene Name dynein axonemal intermediate chain 2
Synonyms C030015H18Rik, b2b3405Clo, Dnaic2
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.220) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 114618234-114648715 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 114645232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 556 (I556L)
Ref Sequence ENSEMBL: ENSMUSP00000065787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069325] [ENSMUST00000092469] [ENSMUST00000141762]
AlphaFold A2AC93
Predicted Effect probably benign
Transcript: ENSMUST00000069325
AA Change: I556L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065787
Gene: ENSMUSG00000034706
AA Change: I556L

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092469
AA Change: I556L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090126
Gene: ENSMUSG00000034706
AA Change: I556L

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141762
AA Change: I544L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114700
Gene: ENSMUSG00000034706
AA Change: I544L

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
low complexity region 458 476 N/A INTRINSIC
low complexity region 507 533 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Dnai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Dnai2 APN 11 114,642,614 (GRCm39) missense probably benign 0.37
IGL01548:Dnai2 APN 11 114,643,768 (GRCm39) missense probably damaging 1.00
IGL02719:Dnai2 APN 11 114,642,737 (GRCm39) missense probably damaging 1.00
IGL03236:Dnai2 APN 11 114,648,075 (GRCm39) unclassified probably benign
R0096:Dnai2 UTSW 11 114,645,158 (GRCm39) missense probably benign 0.04
R0096:Dnai2 UTSW 11 114,645,158 (GRCm39) missense probably benign 0.04
R0305:Dnai2 UTSW 11 114,643,720 (GRCm39) missense probably benign 0.09
R0472:Dnai2 UTSW 11 114,636,015 (GRCm39) splice site probably benign
R0711:Dnai2 UTSW 11 114,645,158 (GRCm39) missense probably benign 0.04
R1756:Dnai2 UTSW 11 114,641,206 (GRCm39) missense probably benign 0.02
R1861:Dnai2 UTSW 11 114,643,777 (GRCm39) missense possibly damaging 0.56
R1916:Dnai2 UTSW 11 114,623,749 (GRCm39) missense possibly damaging 0.88
R1981:Dnai2 UTSW 11 114,623,755 (GRCm39) missense probably damaging 1.00
R1983:Dnai2 UTSW 11 114,626,682 (GRCm39) splice site probably null
R2430:Dnai2 UTSW 11 114,648,012 (GRCm39) unclassified probably benign
R2510:Dnai2 UTSW 11 114,647,993 (GRCm39) unclassified probably benign
R3001:Dnai2 UTSW 11 114,641,297 (GRCm39) missense probably damaging 1.00
R3002:Dnai2 UTSW 11 114,641,297 (GRCm39) missense probably damaging 1.00
R3113:Dnai2 UTSW 11 114,642,756 (GRCm39) splice site probably null
R3803:Dnai2 UTSW 11 114,629,551 (GRCm39) missense probably benign
R3874:Dnai2 UTSW 11 114,623,781 (GRCm39) missense probably damaging 1.00
R4853:Dnai2 UTSW 11 114,635,917 (GRCm39) missense probably benign 0.03
R5267:Dnai2 UTSW 11 114,631,293 (GRCm39) missense probably benign 0.02
R6008:Dnai2 UTSW 11 114,643,816 (GRCm39) missense probably benign 0.01
R6024:Dnai2 UTSW 11 114,643,734 (GRCm39) missense possibly damaging 0.85
R6819:Dnai2 UTSW 11 114,635,917 (GRCm39) missense probably benign 0.00
R7053:Dnai2 UTSW 11 114,629,521 (GRCm39) missense probably damaging 1.00
R7143:Dnai2 UTSW 11 114,645,076 (GRCm39) missense possibly damaging 0.86
R7208:Dnai2 UTSW 11 114,647,988 (GRCm39) missense unknown
R7275:Dnai2 UTSW 11 114,648,054 (GRCm39) missense unknown
R7779:Dnai2 UTSW 11 114,645,235 (GRCm39) missense possibly damaging 0.50
R7899:Dnai2 UTSW 11 114,629,456 (GRCm39) missense probably benign 0.21
R8443:Dnai2 UTSW 11 114,645,275 (GRCm39) missense unknown
R8944:Dnai2 UTSW 11 114,641,302 (GRCm39) missense possibly damaging 0.58
R9081:Dnai2 UTSW 11 114,629,493 (GRCm39) missense probably damaging 0.97
R9182:Dnai2 UTSW 11 114,623,839 (GRCm39) missense probably benign 0.17
R9335:Dnai2 UTSW 11 114,625,489 (GRCm39) missense probably benign 0.01
R9380:Dnai2 UTSW 11 114,635,989 (GRCm39) missense probably benign 0.12
RF012:Dnai2 UTSW 11 114,641,242 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAACGTGAAACCCGGC -3'
(R):5'- CATGGGAGACGAATTTCTTCAG -3'

Sequencing Primer
(F):5'- CGTGAGATGCGACTGAAG -3'
(R):5'- TTATCAGTGGCCAGTCAAGATCC -3'
Posted On 2019-10-07