Incidental Mutation 'R7463:Dnaic2'
ID578577
Institutional Source Beutler Lab
Gene Symbol Dnaic2
Ensembl Gene ENSMUSG00000034706
Gene Namedynein, axonemal, intermediate chain 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location114727408-114757889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114754406 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 556 (I556L)
Ref Sequence ENSEMBL: ENSMUSP00000065787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069325] [ENSMUST00000092469] [ENSMUST00000141762]
Predicted Effect probably benign
Transcript: ENSMUST00000069325
AA Change: I556L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065787
Gene: ENSMUSG00000034706
AA Change: I556L

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092469
AA Change: I556L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090126
Gene: ENSMUSG00000034706
AA Change: I556L

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141762
AA Change: I544L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114700
Gene: ENSMUSG00000034706
AA Change: I544L

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
low complexity region 458 476 N/A INTRINSIC
low complexity region 507 533 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Dnaic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Dnaic2 APN 11 114751788 missense probably benign 0.37
IGL01548:Dnaic2 APN 11 114752942 missense probably damaging 1.00
IGL02719:Dnaic2 APN 11 114751911 missense probably damaging 1.00
IGL03236:Dnaic2 APN 11 114757249 unclassified probably benign
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0305:Dnaic2 UTSW 11 114752894 missense probably benign 0.09
R0472:Dnaic2 UTSW 11 114745189 splice site probably benign
R0711:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R1756:Dnaic2 UTSW 11 114750380 missense probably benign 0.02
R1861:Dnaic2 UTSW 11 114752951 missense possibly damaging 0.56
R1916:Dnaic2 UTSW 11 114732923 missense possibly damaging 0.88
R1981:Dnaic2 UTSW 11 114732929 missense probably damaging 1.00
R1983:Dnaic2 UTSW 11 114735856 splice site probably null
R2430:Dnaic2 UTSW 11 114757186 unclassified probably benign
R2510:Dnaic2 UTSW 11 114757167 unclassified probably benign
R3001:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3002:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3113:Dnaic2 UTSW 11 114751930 splice site probably null
R3803:Dnaic2 UTSW 11 114738725 missense probably benign
R3874:Dnaic2 UTSW 11 114732955 missense probably damaging 1.00
R4853:Dnaic2 UTSW 11 114745091 missense probably benign 0.03
R5267:Dnaic2 UTSW 11 114740467 missense probably benign 0.02
R6008:Dnaic2 UTSW 11 114752990 missense probably benign 0.01
R6024:Dnaic2 UTSW 11 114752908 missense possibly damaging 0.85
R6819:Dnaic2 UTSW 11 114745091 missense probably benign 0.00
R7053:Dnaic2 UTSW 11 114738695 missense probably damaging 1.00
R7143:Dnaic2 UTSW 11 114754250 missense possibly damaging 0.86
R7208:Dnaic2 UTSW 11 114757162 missense unknown
R7275:Dnaic2 UTSW 11 114757228 missense unknown
R7779:Dnaic2 UTSW 11 114754409 missense possibly damaging 0.50
R7899:Dnaic2 UTSW 11 114738630 missense probably benign 0.21
RF012:Dnaic2 UTSW 11 114750416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAACGTGAAACCCGGC -3'
(R):5'- CATGGGAGACGAATTTCTTCAG -3'

Sequencing Primer
(F):5'- CGTGAGATGCGACTGAAG -3'
(R):5'- TTATCAGTGGCCAGTCAAGATCC -3'
Posted On2019-10-07