Mutagenetix > Incidental Mutations

Incidental Mutation 'R7463:Dnaic2'

578577

Institutional Source

Beutler Lab

Gene Symbol

Dnaic2

Ensembl Gene

ENSMUSG00000034706

Gene Name

dynein, axonemal, intermediate chain 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114727408-114757889 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 114754406 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 556 (I556L)

Ref Sequence

ENSEMBL: ENSMUSP00000065787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069325] [ENSMUST00000092469] [ENSMUST00000141762]

Predicted Effect

probably benign
Transcript: ENSMUST00000069325
AA Change: I556L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000065787
Gene: ENSMUSG00000034706
AA Change: I556L

Domain	Start	End	E-Value	Type
low complexity region	127	146	N/A	INTRINSIC
WD40	206	245	2.86e0	SMART
WD40	248	293	3.33e-1	SMART
WD40	353	392	7.92e-3	SMART
WD40	396	436	2.05e1	SMART
WD40	441	480	4.93e1	SMART
low complexity region	519	545	N/A	INTRINSIC
low complexity region	559	608	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092469
AA Change: I556L

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000090126
Gene: ENSMUSG00000034706
AA Change: I556L

Domain	Start	End	E-Value	Type
low complexity region	127	146	N/A	INTRINSIC
WD40	206	245	2.86e0	SMART
WD40	248	293	3.33e-1	SMART
WD40	353	392	7.92e-3	SMART
WD40	396	436	2.05e1	SMART
WD40	441	480	4.93e1	SMART
low complexity region	519	545	N/A	INTRINSIC
low complexity region	559	608	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141762
AA Change: I544L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000114700
Gene: ENSMUSG00000034706
AA Change: I544L

Domain	Start	End	E-Value	Type
low complexity region	127	146	N/A	INTRINSIC
WD40	206	245	2.86e0	SMART
WD40	248	293	3.33e-1	SMART
WD40	353	392	7.92e-3	SMART
WD40	396	436	2.05e1	SMART
low complexity region	458	476	N/A	INTRINSIC
low complexity region	507	533	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC

Meta Mutation Damage Score

0.0723

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and immotile respiratory cilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnmt1	C	T	9: 20,912,225	V1147M	possibly damaging	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hgf	G	A	5: 16,578,450	D253N	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Igf2r	T	C	17: 12,710,645	T958A	probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Olfr979	A	G	9: 40,000,564	V221A	probably benign	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Vmn2r102	A	T	17: 19,676,624	N78Y	probably damaging	Het
Wdr11	A	T	7: 129,607,086	D427V	probably damaging	Het
Zer1	A	T	2: 30,113,437		probably benign	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Dnaic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Dnaic2	APN	11	114751788	missense	probably benign	0.37
IGL01548:Dnaic2	APN	11	114752942	missense	probably damaging	1.00
IGL02719:Dnaic2	APN	11	114751911	missense	probably damaging	1.00
IGL03236:Dnaic2	APN	11	114757249	unclassified	probably benign
R0096:Dnaic2	UTSW	11	114754332	missense	probably benign	0.04
R0096:Dnaic2	UTSW	11	114754332	missense	probably benign	0.04
R0305:Dnaic2	UTSW	11	114752894	missense	probably benign	0.09
R0472:Dnaic2	UTSW	11	114745189	splice site	probably benign
R0711:Dnaic2	UTSW	11	114754332	missense	probably benign	0.04
R1756:Dnaic2	UTSW	11	114750380	missense	probably benign	0.02
R1861:Dnaic2	UTSW	11	114752951	missense	possibly damaging	0.56
R1916:Dnaic2	UTSW	11	114732923	missense	possibly damaging	0.88
R1981:Dnaic2	UTSW	11	114732929	missense	probably damaging	1.00
R1983:Dnaic2	UTSW	11	114735856	splice site	probably null
R2430:Dnaic2	UTSW	11	114757186	unclassified	probably benign
R2510:Dnaic2	UTSW	11	114757167	unclassified	probably benign
R3001:Dnaic2	UTSW	11	114750471	missense	probably damaging	1.00
R3002:Dnaic2	UTSW	11	114750471	missense	probably damaging	1.00
R3113:Dnaic2	UTSW	11	114751930	splice site	probably null
R3803:Dnaic2	UTSW	11	114738725	missense	probably benign
R3874:Dnaic2	UTSW	11	114732955	missense	probably damaging	1.00
R4853:Dnaic2	UTSW	11	114745091	missense	probably benign	0.03
R5267:Dnaic2	UTSW	11	114740467	missense	probably benign	0.02
R6008:Dnaic2	UTSW	11	114752990	missense	probably benign	0.01
R6024:Dnaic2	UTSW	11	114752908	missense	possibly damaging	0.85
R6819:Dnaic2	UTSW	11	114745091	missense	probably benign	0.00
R7053:Dnaic2	UTSW	11	114738695	missense	probably damaging	1.00
R7143:Dnaic2	UTSW	11	114754250	missense	possibly damaging	0.86
R7208:Dnaic2	UTSW	11	114757162	missense	unknown
R7275:Dnaic2	UTSW	11	114757228	missense	unknown
R7779:Dnaic2	UTSW	11	114754409	missense	possibly damaging	0.50
R7899:Dnaic2	UTSW	11	114738630	missense	probably benign	0.21
R8443:Dnaic2	UTSW	11	114754449	missense	unknown
R8944:Dnaic2	UTSW	11	114750476	missense	possibly damaging	0.58
R9081:Dnaic2	UTSW	11	114738667	missense	probably damaging	0.97
RF012:Dnaic2	UTSW	11	114750416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGAACGTGAAACCCGGC -3'
(R):5'- CATGGGAGACGAATTTCTTCAG -3'

Sequencing Primer
(F):5'- CGTGAGATGCGACTGAAG -3'
(R):5'- TTATCAGTGGCCAGTCAAGATCC -3'

Posted On

2019-10-07