Incidental Mutation 'R7463:Tmem94'
ID 578578
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Name transmembrane protein 94
Synonyms 2310067B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R7463 (G1)
Quality Score 203.009
Status Validated
Chromosome 11
Chromosomal Location 115765433-115799366 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115786256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 118 (R118L)
Ref Sequence ENSEMBL: ENSMUSP00000091440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000103034] [ENSMUST00000125918] [ENSMUST00000136720] [ENSMUST00000141871]
AlphaFold Q7TSH8
Predicted Effect possibly damaging
Transcript: ENSMUST00000093912
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103033
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103034
AA Change: R74L
SMART Domains Protein: ENSMUSP00000099323
Gene: ENSMUSG00000020747
AA Change: R74L

DomainStartEndE-ValueType
transmembrane domain 52 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136720
SMART Domains Protein: ENSMUSP00000122111
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141871
SMART Domains Protein: ENSMUSP00000118396
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115795328 missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115790284 missense probably benign 0.25
IGL01314:Tmem94 APN 11 115790009 missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115787538 missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115797432 missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115793071 missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115796401 nonsense probably null
IGL02816:Tmem94 APN 11 115788704 splice site probably null
IGL02836:Tmem94 APN 11 115792939 missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115792421 missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115792398 missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115792068 unclassified probably benign
IGL03397:Tmem94 APN 11 115787568 unclassified probably benign
capitulate UTSW 11 115796746 missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115796724 unclassified probably benign
R0336:Tmem94 UTSW 11 115787385 missense probably benign
R0370:Tmem94 UTSW 11 115788717 missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115794781 splice site probably null
R0638:Tmem94 UTSW 11 115792060 splice site probably null
R0647:Tmem94 UTSW 11 115796795 missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115791978 missense probably benign 0.00
R1469:Tmem94 UTSW 11 115795091 unclassified probably benign
R1616:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R1621:Tmem94 UTSW 11 115785845 missense probably benign
R1682:Tmem94 UTSW 11 115790230 missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115794748 missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115796754 missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115793213 nonsense probably null
R1926:Tmem94 UTSW 11 115792900 missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115788674 missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115794328 missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115794749 missense probably benign
R2419:Tmem94 UTSW 11 115796815 missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115791961 missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115789254 missense probably benign 0.00
R4708:Tmem94 UTSW 11 115786295 missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115796112 nonsense probably null
R5026:Tmem94 UTSW 11 115793104 missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115793190 missense probably benign 0.04
R5716:Tmem94 UTSW 11 115792428 missense probably benign 0.17
R6180:Tmem94 UTSW 11 115791031 critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115796746 missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115798286 missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115791988 missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115796461 missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115785830 missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115792938 missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115790955 splice site probably null
R7181:Tmem94 UTSW 11 115794774 missense probably damaging 0.97
R7290:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7292:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7345:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115794174 missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R7460:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115788378 missense probably benign 0.05
R7995:Tmem94 UTSW 11 115797971 missense probably damaging 1.00
R8094:Tmem94 UTSW 11 115788392 critical splice donor site probably null
R8447:Tmem94 UTSW 11 115797197 missense possibly damaging 0.93
R8447:Tmem94 UTSW 11 115797870 missense probably benign
R8825:Tmem94 UTSW 11 115797375 missense probably benign 0.00
R8910:Tmem94 UTSW 11 115797426 missense probably damaging 1.00
R9226:Tmem94 UTSW 11 115792365 missense probably damaging 1.00
RF003:Tmem94 UTSW 11 115796132 missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115786253 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTGAGGAGCTGTAGTGACC -3'
(R):5'- CCAGTACCAGTGGACAAGACAG -3'

Sequencing Primer
(F):5'- CTGTAGTGACCCGAGCATAG -3'
(R):5'- GGGGGTAAAAACTCTCAACTTCC -3'
Posted On 2019-10-07