Incidental Mutation 'R7463:Tmem94'
ID 578578
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Name transmembrane protein 94
Synonyms 2310067B10Rik
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R7463 (G1)
Quality Score 203.009
Status Validated
Chromosome 11
Chromosomal Location 115656245-115689859 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115677082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 118 (R118L)
Ref Sequence ENSEMBL: ENSMUSP00000091440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000103034] [ENSMUST00000125918] [ENSMUST00000136720] [ENSMUST00000141871]
AlphaFold Q7TSH8
Predicted Effect possibly damaging
Transcript: ENSMUST00000093912
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103033
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103034
AA Change: R74L
SMART Domains Protein: ENSMUSP00000099323
Gene: ENSMUSG00000020747
AA Change: R74L

DomainStartEndE-ValueType
transmembrane domain 52 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136720
SMART Domains Protein: ENSMUSP00000122111
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141871
SMART Domains Protein: ENSMUSP00000118396
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115,686,154 (GRCm39) missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115,681,110 (GRCm39) missense probably benign 0.25
IGL01314:Tmem94 APN 11 115,680,835 (GRCm39) missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115,678,364 (GRCm39) missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115,685,571 (GRCm39) missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115,685,571 (GRCm39) missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115,688,258 (GRCm39) missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115,683,897 (GRCm39) missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115,687,227 (GRCm39) nonsense probably null
IGL02816:Tmem94 APN 11 115,679,530 (GRCm39) splice site probably null
IGL02836:Tmem94 APN 11 115,683,765 (GRCm39) missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115,683,247 (GRCm39) missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115,683,224 (GRCm39) missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115,682,894 (GRCm39) unclassified probably benign
IGL03397:Tmem94 APN 11 115,678,394 (GRCm39) unclassified probably benign
capitulate UTSW 11 115,687,572 (GRCm39) missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115,687,550 (GRCm39) unclassified probably benign
R0336:Tmem94 UTSW 11 115,678,211 (GRCm39) missense probably benign
R0370:Tmem94 UTSW 11 115,679,543 (GRCm39) missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115,685,607 (GRCm39) splice site probably null
R0638:Tmem94 UTSW 11 115,682,886 (GRCm39) splice site probably null
R0647:Tmem94 UTSW 11 115,687,621 (GRCm39) missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115,682,804 (GRCm39) missense probably benign 0.00
R1469:Tmem94 UTSW 11 115,685,917 (GRCm39) unclassified probably benign
R1616:Tmem94 UTSW 11 115,686,971 (GRCm39) critical splice donor site probably null
R1621:Tmem94 UTSW 11 115,676,671 (GRCm39) missense probably benign
R1682:Tmem94 UTSW 11 115,681,056 (GRCm39) missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115,685,574 (GRCm39) missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115,687,580 (GRCm39) missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115,684,039 (GRCm39) nonsense probably null
R1926:Tmem94 UTSW 11 115,683,726 (GRCm39) missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115,679,500 (GRCm39) missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115,685,154 (GRCm39) missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115,685,575 (GRCm39) missense probably benign
R2419:Tmem94 UTSW 11 115,687,641 (GRCm39) missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115,682,787 (GRCm39) missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115,680,080 (GRCm39) missense probably benign 0.00
R4708:Tmem94 UTSW 11 115,677,121 (GRCm39) missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115,686,938 (GRCm39) nonsense probably null
R5026:Tmem94 UTSW 11 115,683,930 (GRCm39) missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115,684,016 (GRCm39) missense probably benign 0.04
R5716:Tmem94 UTSW 11 115,683,254 (GRCm39) missense probably benign 0.17
R6180:Tmem94 UTSW 11 115,681,857 (GRCm39) critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115,687,572 (GRCm39) missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115,689,112 (GRCm39) missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115,682,814 (GRCm39) missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115,687,287 (GRCm39) missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115,676,656 (GRCm39) missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115,683,764 (GRCm39) missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115,681,781 (GRCm39) splice site probably null
R7181:Tmem94 UTSW 11 115,685,600 (GRCm39) missense probably damaging 0.97
R7290:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7292:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7345:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115,685,000 (GRCm39) missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115,686,971 (GRCm39) critical splice donor site probably null
R7460:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115,679,204 (GRCm39) missense probably benign 0.05
R7995:Tmem94 UTSW 11 115,688,797 (GRCm39) missense probably damaging 1.00
R8094:Tmem94 UTSW 11 115,679,218 (GRCm39) critical splice donor site probably null
R8447:Tmem94 UTSW 11 115,688,696 (GRCm39) missense probably benign
R8447:Tmem94 UTSW 11 115,688,023 (GRCm39) missense possibly damaging 0.93
R8825:Tmem94 UTSW 11 115,688,201 (GRCm39) missense probably benign 0.00
R8910:Tmem94 UTSW 11 115,688,252 (GRCm39) missense probably damaging 1.00
R9226:Tmem94 UTSW 11 115,683,191 (GRCm39) missense probably damaging 1.00
RF003:Tmem94 UTSW 11 115,686,958 (GRCm39) missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115,677,079 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTGAGGAGCTGTAGTGACC -3'
(R):5'- CCAGTACCAGTGGACAAGACAG -3'

Sequencing Primer
(F):5'- CTGTAGTGACCCGAGCATAG -3'
(R):5'- GGGGGTAAAAACTCTCAACTTCC -3'
Posted On 2019-10-07