Incidental Mutation 'R7463:Olfr1510'
ID578582
Institutional Source Beutler Lab
Gene Symbol Olfr1510
Ensembl Gene ENSMUSG00000063106
Gene Nameolfactory receptor 1510
SynonymsGA_x6K02T2RJGY-583652-584608, MOR223-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52409131-52414373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52410711 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 54 (W54R)
Ref Sequence ENSEMBL: ENSMUSP00000150294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079459] [ENSMUST00000215928]
Predicted Effect probably benign
Transcript: ENSMUST00000079459
AA Change: W54R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078424
Gene: ENSMUSG00000063106
AA Change: W54R

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 8.1e-50 PFAM
Pfam:7tm_1 45 293 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215928
AA Change: W54R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Olfr1510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Olfr1510 APN 14 52410842 missense probably benign 0.04
IGL02097:Olfr1510 APN 14 52410054 missense probably benign
R0282:Olfr1510 UTSW 14 52410263 missense possibly damaging 0.94
R1449:Olfr1510 UTSW 14 52410567 missense probably damaging 1.00
R2113:Olfr1510 UTSW 14 52410296 missense probably damaging 1.00
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2873:Olfr1510 UTSW 14 52410861 missense probably benign
R3409:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R3411:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R4480:Olfr1510 UTSW 14 52410308 missense probably damaging 1.00
R5292:Olfr1510 UTSW 14 52410445 missense possibly damaging 0.90
R5297:Olfr1510 UTSW 14 52410218 missense probably damaging 1.00
R5441:Olfr1510 UTSW 14 52409957 missense probably benign 0.02
R5749:Olfr1510 UTSW 14 52410504 missense probably damaging 1.00
R5872:Olfr1510 UTSW 14 52410768 missense probably damaging 1.00
R5941:Olfr1510 UTSW 14 52410068 missense probably benign 0.01
R7209:Olfr1510 UTSW 14 52410093 missense possibly damaging 0.80
R7379:Olfr1510 UTSW 14 52410261 missense probably benign 0.08
R7692:Olfr1510 UTSW 14 52410488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAAGAGGCTGGCATATTG -3'
(R):5'- GCTAGCCACTGGTCATCAAAC -3'

Sequencing Primer
(F):5'- CCTGTCATAGGCCATCAAAGTGTAG -3'
(R):5'- CATGGTTCATCTTAACAGACTAAGAC -3'
Posted On2019-10-07