Incidental Mutation 'R7463:Fer1l6'
ID578584
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7463 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 58573601 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 573 (Y573*)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect probably null
Transcript: ENSMUST00000161028
AA Change: Y573*
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: Y573*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 unclassified probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAACCACATAACCGGCG -3'
(R):5'- CCAATTCAGTGTTACTTAACCTGAGG -3'

Sequencing Primer
(F):5'- ACATAACCGGCGTTCACTG -3'
(R):5'- GTGTTACTTAACCTGAGGTCAAGACC -3'
Posted On2019-10-07