Incidental Mutation 'R7463:Racgap1'
ID 578585
Institutional Source Beutler Lab
Gene Symbol Racgap1
Ensembl Gene ENSMUSG00000023015
Gene Name Rac GTPase-activating protein 1
Synonyms Band25, gtl11, GTPase, MgcRacGAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 99620496-99651656 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 99642958 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 4 (T4S)
Ref Sequence ENSEMBL: ENSMUSP00000023756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023756] [ENSMUST00000109581] [ENSMUST00000164983] [ENSMUST00000165730] [ENSMUST00000168065] [ENSMUST00000169810] [ENSMUST00000171702] [ENSMUST00000171908]
AlphaFold Q9WVM1
Predicted Effect probably benign
Transcript: ENSMUST00000023756
AA Change: T4S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023756
Gene: ENSMUSG00000023015
AA Change: T4S

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109581
AA Change: T4S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000164983
AA Change: T4S
Predicted Effect unknown
Transcript: ENSMUST00000165730
AA Change: T4S
Predicted Effect probably benign
Transcript: ENSMUST00000168065
SMART Domains Protein: ENSMUSP00000132732
Gene: ENSMUSG00000023015

DomainStartEndE-ValueType
coiled coil region 6 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169810
AA Change: T4S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130876
Gene: ENSMUSG00000023015
AA Change: T4S

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171702
AA Change: T4S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126417
Gene: ENSMUSG00000023015
AA Change: T4S

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171908
AA Change: T4S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128892
Gene: ENSMUSG00000023015
AA Change: T4S

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex. This protein binds activated forms of Rho GTPases and stimulates GTP hydrolysis, which results in negative regulation of Rho-mediated signals. This protein plays a regulatory role in cytokinesis, cell growth, and differentiation. Alternatively spliced transcript variants have been found for this gene. There is a pseudogene for this gene on chromosome 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: Embryos homozygous for a gene-trapped allele exhibit pre-implantation lethality associated with the formation of multinucleated blastomeres and failure to complete cytokinesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Racgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Racgap1 APN 15 99636122 unclassified probably benign
IGL01450:Racgap1 APN 15 99626363 missense probably benign 0.00
IGL01907:Racgap1 APN 15 99626333 nonsense probably null
IGL02584:Racgap1 APN 15 99623634 missense probably benign 0.00
IGL02733:Racgap1 APN 15 99639704 missense probably damaging 1.00
IGL03137:Racgap1 APN 15 99628741 missense probably damaging 0.96
IGL03145:Racgap1 APN 15 99623640 missense probably benign 0.00
IGL02799:Racgap1 UTSW 15 99632747 missense probably benign 0.09
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0140:Racgap1 UTSW 15 99623651 missense probably benign 0.00
R0398:Racgap1 UTSW 15 99628627 splice site probably benign
R0496:Racgap1 UTSW 15 99639832 splice site probably benign
R0528:Racgap1 UTSW 15 99628706 missense probably damaging 1.00
R0893:Racgap1 UTSW 15 99626530 missense probably benign
R0947:Racgap1 UTSW 15 99624314 missense possibly damaging 0.83
R1348:Racgap1 UTSW 15 99626365 missense possibly damaging 0.54
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1720:Racgap1 UTSW 15 99628769 nonsense probably null
R2235:Racgap1 UTSW 15 99626536 missense probably benign
R3624:Racgap1 UTSW 15 99642891 missense probably damaging 0.97
R4621:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4622:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4623:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R5046:Racgap1 UTSW 15 99628762 missense probably damaging 1.00
R5899:Racgap1 UTSW 15 99623628 missense possibly damaging 0.80
R6306:Racgap1 UTSW 15 99623953 missense probably benign
R6513:Racgap1 UTSW 15 99624275 missense probably damaging 1.00
R6618:Racgap1 UTSW 15 99623994 missense probably damaging 0.97
R6953:Racgap1 UTSW 15 99626329 missense probably damaging 1.00
R7359:Racgap1 UTSW 15 99631200 missense probably benign
R8292:Racgap1 UTSW 15 99622246 nonsense probably null
R8883:Racgap1 UTSW 15 99628659 missense probably benign 0.00
R9227:Racgap1 UTSW 15 99636197 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTGGCCATAAGCAGCCATC -3'
(R):5'- GATCACGAAGAATTGTCGGC -3'

Sequencing Primer
(F):5'- AGCTTTTGGACTGCAACACG -3'
(R):5'- AAGAATTGTCGGCGTGAGATTCTTAC -3'
Posted On 2019-10-07