Incidental Mutation 'R7463:Dip2b'
ID578586
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100154157 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 213 (E213G)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
Predicted Effect probably benign
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: E213G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: E213G

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
R7002:Dip2b UTSW 15 100160465 missense probably benign 0.43
R7076:Dip2b UTSW 15 100157972 splice site probably null
R7176:Dip2b UTSW 15 100169318 missense probably damaging 1.00
R7255:Dip2b UTSW 15 100209627 missense probably benign 0.00
R7513:Dip2b UTSW 15 100207748 splice site probably null
R7876:Dip2b UTSW 15 100191041 missense probably benign 0.02
R8368:Dip2b UTSW 15 100154243 missense probably benign 0.00
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTGCACTCTGTAAACACG -3'
(R):5'- CTAGCATCTACCAATGGAGCTC -3'

Sequencing Primer
(F):5'- TCGTGCACTCTGTAAACACGTATAC -3'
(R):5'- TGGAGCTCCATACCATCAGCTG -3'
Posted On2019-10-07