Mutagenetix > Incidental Mutation

Incidental Mutation 'R7463:Igf2r'

578587

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12710645 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 958 (T958A)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably benign
Transcript: ENSMUST00000024599
AA Change: T958A

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: T958A

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnaic2	A	C	11: 114,754,406	I556L	probably benign	Het
Dnmt1	C	T	9: 20,912,225	V1147M	possibly damaging	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hgf	G	A	5: 16,578,450	D253N	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Olfr979	A	G	9: 40,000,564	V221A	probably benign	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Vmn2r102	A	T	17: 19,676,624	N78Y	probably damaging	Het
Wdr11	A	T	7: 129,607,086	D427V	probably damaging	Het
Zer1	A	T	2: 30,113,437		probably benign	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGAAAACTGCCCATCTAACTG -3'
(R):5'- AATGAGCGGCAATGGGTTTC -3'

Sequencing Primer
(F):5'- CCATCTAACTGCATGAGGACTGTG -3'
(R):5'- CGGCAATGGGTTTCTGCAG -3'

Posted On

2019-10-07