Mutagenetix > Incidental Mutation

Incidental Mutation 'R7463:Vmn2r102'

578588

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r102

Ensembl Gene

ENSMUSG00000095961

Gene Name

vomeronasal 2, receptor 102

Synonyms

EG224572

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19660399-19694748 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19676624 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 78 (N78Y)

Ref Sequence

ENSEMBL: ENSMUSP00000126559 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171741]

AlphaFold

L7N279

Predicted Effect

probably damaging
Transcript: ENSMUST00000171741
AA Change: N78Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: N78Y

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	448	5.2e-38	PFAM
Pfam:NCD3G	509	562	1.1e-21	PFAM
Pfam:7tm_3	595	830	1.8e-53	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,323,772	V435E	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy2	T	C	13: 68,730,280	D413G	probably damaging	Het
Adgrg6	T	A	10: 14,434,396	D727V	possibly damaging	Het
Aebp2	C	T	6: 140,637,726	Q309*	probably null	Het
Amy1	A	T	3: 113,569,884	C43*	probably null	Het
Bpifc	T	C	10: 85,979,334	E256G	probably benign	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Carmil3	C	T	14: 55,502,396	P980L	probably damaging	Het
Coch	T	A	12: 51,593,625	M1K	probably null	Het
Cpt2	A	T	4: 107,908,157	F137I	probably damaging	Het
Crem	T	C	18: 3,295,094	I112V	probably benign	Het
Cul9	A	G	17: 46,520,476		probably null	Het
Cyp3a41a	T	A	5: 145,713,564	I90F	probably damaging	Het
Cyp4f16	C	T	17: 32,550,787	A457V	possibly damaging	Het
Ddx6	A	G	9: 44,628,729	E318G	probably damaging	Het
Dip2b	A	G	15: 100,154,157	E213G	probably benign	Het
Dlx5	T	C	6: 6,878,316	H238R	probably damaging	Het
Dnaic2	A	C	11: 114,754,406	I556L	probably benign	Het
Dnmt1	C	T	9: 20,912,225	V1147M	possibly damaging	Het
Egf	G	T	3: 129,740,015	Q59K	probably benign	Het
Ermp1	A	T	19: 29,646,262	Y109*	probably null	Het
Fer1l6	T	A	15: 58,573,601	Y573*	probably null	Het
Fmnl1	T	C	11: 103,193,128	L503P	probably damaging	Het
Gnptab	T	G	10: 88,431,389	I447M	probably damaging	Het
Hgf	G	A	5: 16,578,450	D253N	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Igf2r	T	C	17: 12,710,645	T958A	probably benign	Het
Kcnd2	T	A	6: 21,216,498	L67Q	probably damaging	Het
Kif5a	A	G	10: 127,243,724	V248A	probably damaging	Het
Krt33b	A	G	11: 100,029,563	I88T	probably damaging	Het
Lhx2	G	A	2: 38,351,846	E25K	possibly damaging	Het
Mex3d	C	T	10: 80,381,698	G562R		Het
Myom2	A	T	8: 15,117,679	Y1088F	probably null	Het
Ncapg	T	A	5: 45,694,092		probably null	Het
Nudc	A	C	4: 133,534,403	V190G	possibly damaging	Het
Obscn	G	T	11: 59,122,860	R1054S	probably benign	Het
Olfr1045	T	C	2: 86,197,838	M305V	probably benign	Het
Olfr1510	A	G	14: 52,410,711	W54R	probably benign	Het
Olfr651	T	C	7: 104,553,482	S188P	possibly damaging	Het
Olfr683	T	A	7: 105,143,937	M119L	probably benign	Het
Olfr710	A	T	7: 106,944,173	V276E	probably damaging	Het
Olfr979	A	G	9: 40,000,564	V221A	probably benign	Het
Pcdh10	A	T	3: 45,383,572	R891S	possibly damaging	Het
Pcdh15	C	T	10: 74,631,770	S1873L	possibly damaging	Het
Pcdh7	A	G	5: 57,720,998	K632E	probably benign	Het
Pcdhgb8	G	A	18: 37,763,427	A517T	probably damaging	Het
Ptgr2	A	T	12: 84,292,298		probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Racgap1	T	A	15: 99,642,958	T4S	probably benign	Het
Rb1cc1	A	G	1: 6,249,180	H941R	probably benign	Het
Reln	T	C	5: 22,103,435	H312R	probably damaging	Het
Rnf166	T	A	8: 122,467,987	H208L	probably damaging	Het
Theg	T	C	10: 79,576,715	E314G	probably damaging	Het
Timeless	T	C	10: 128,250,426	S999P	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tor1aip1	A	T	1: 156,007,609	H349Q	possibly damaging	Het
Ttn	T	A	2: 76,920,460	E3415V	probably benign	Het
Wdr11	A	T	7: 129,607,086	D427V	probably damaging	Het
Zer1	A	T	2: 30,113,437		probably benign	Het
Zfp516	T	A	18: 82,957,108	M477K	probably benign	Het

Other mutations in Vmn2r102

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Vmn2r102	APN	17	19678892	missense	probably damaging	1.00
IGL00974:Vmn2r102	APN	17	19677509	missense	possibly damaging	0.93
IGL00978:Vmn2r102	APN	17	19678923	splice site	probably null
IGL01589:Vmn2r102	APN	17	19678804	missense	probably benign
IGL01738:Vmn2r102	APN	17	19677758	missense	probably damaging	1.00
IGL01994:Vmn2r102	APN	17	19660469	missense	probably benign	0.00
IGL02066:Vmn2r102	APN	17	19693929	missense	probably benign	0.01
IGL02525:Vmn2r102	APN	17	19681185	missense	probably benign
IGL02589:Vmn2r102	APN	17	19681218	missense	probably damaging	1.00
IGL02814:Vmn2r102	APN	17	19677908	missense	probably damaging	1.00
IGL03028:Vmn2r102	APN	17	19694066	missense	possibly damaging	0.92
IGL03162:Vmn2r102	APN	17	19694024	missense	probably damaging	1.00
PIT4431001:Vmn2r102	UTSW	17	19676696	missense	possibly damaging	0.68
R0042:Vmn2r102	UTSW	17	19660589	missense	probably damaging	0.98
R0131:Vmn2r102	UTSW	17	19678763	missense	probably benign	0.42
R0131:Vmn2r102	UTSW	17	19678763	missense	probably benign	0.42
R0132:Vmn2r102	UTSW	17	19678763	missense	probably benign	0.42
R0268:Vmn2r102	UTSW	17	19677850	missense	probably benign	0.00
R0441:Vmn2r102	UTSW	17	19694368	missense	probably damaging	1.00
R0583:Vmn2r102	UTSW	17	19676781	missense	probably benign	0.01
R0600:Vmn2r102	UTSW	17	19678015	missense	probably benign	0.00
R0606:Vmn2r102	UTSW	17	19678844	missense	possibly damaging	0.93
R0674:Vmn2r102	UTSW	17	19677867	missense	probably benign	0.00
R0709:Vmn2r102	UTSW	17	19677619	missense	probably benign	0.01
R0879:Vmn2r102	UTSW	17	19694192	missense	probably damaging	1.00
R1349:Vmn2r102	UTSW	17	19660625	splice site	probably benign
R1473:Vmn2r102	UTSW	17	19694581	missense	probably benign	0.00
R1630:Vmn2r102	UTSW	17	19678770	missense	possibly damaging	0.60
R1727:Vmn2r102	UTSW	17	19677508	missense	probably damaging	0.99
R1759:Vmn2r102	UTSW	17	19694493	missense	probably damaging	1.00
R1809:Vmn2r102	UTSW	17	19677619	missense	probably benign	0.01
R2013:Vmn2r102	UTSW	17	19676744	missense	probably benign	0.03
R2086:Vmn2r102	UTSW	17	19676687	missense	probably damaging	1.00
R2241:Vmn2r102	UTSW	17	19676741	missense	probably benign	0.00
R2378:Vmn2r102	UTSW	17	19694668	missense	probably damaging	1.00
R3814:Vmn2r102	UTSW	17	19678831	missense	probably damaging	0.98
R3827:Vmn2r102	UTSW	17	19694525	missense	probably damaging	1.00
R4159:Vmn2r102	UTSW	17	19677826	missense	probably damaging	1.00
R4505:Vmn2r102	UTSW	17	19660583	missense	probably benign	0.00
R4515:Vmn2r102	UTSW	17	19681213	missense	probably damaging	1.00
R4517:Vmn2r102	UTSW	17	19681213	missense	probably damaging	1.00
R4534:Vmn2r102	UTSW	17	19694713	missense	probably benign
R4535:Vmn2r102	UTSW	17	19694713	missense	probably benign
R4662:Vmn2r102	UTSW	17	19681162	missense	probably damaging	1.00
R4708:Vmn2r102	UTSW	17	19694314	missense	probably benign	0.00
R4734:Vmn2r102	UTSW	17	19677533	missense	probably damaging	1.00
R4834:Vmn2r102	UTSW	17	19677941	missense	probably damaging	0.99
R4927:Vmn2r102	UTSW	17	19660399	start codon destroyed	probably benign	0.00
R5077:Vmn2r102	UTSW	17	19677572	missense	probably benign	0.20
R5181:Vmn2r102	UTSW	17	19676741	missense	probably benign	0.00
R5277:Vmn2r102	UTSW	17	19694131	missense	possibly damaging	0.49
R5418:Vmn2r102	UTSW	17	19694153	missense	probably damaging	1.00
R5810:Vmn2r102	UTSW	17	19677542	missense	probably benign	0.20
R5864:Vmn2r102	UTSW	17	19694681	missense	possibly damaging	0.55
R6168:Vmn2r102	UTSW	17	19694140	missense	possibly damaging	0.83
R6266:Vmn2r102	UTSW	17	19678745	missense	probably benign
R6432:Vmn2r102	UTSW	17	19681221	missense	possibly damaging	0.61
R6487:Vmn2r102	UTSW	17	19677907	missense	probably damaging	1.00
R6597:Vmn2r102	UTSW	17	19694188	missense	probably damaging	0.99
R6797:Vmn2r102	UTSW	17	19660432	nonsense	probably null
R7009:Vmn2r102	UTSW	17	19694194	missense	probably damaging	0.99
R7098:Vmn2r102	UTSW	17	19694408	missense	probably damaging	1.00
R7134:Vmn2r102	UTSW	17	19677487	missense	probably benign	0.01
R7511:Vmn2r102	UTSW	17	19681143	missense	probably damaging	1.00
R7512:Vmn2r102	UTSW	17	19694101	missense	probably damaging	1.00
R7556:Vmn2r102	UTSW	17	19677831	missense	probably benign
R8126:Vmn2r102	UTSW	17	19660450	missense	probably benign	0.02
R8385:Vmn2r102	UTSW	17	19693826	missense	possibly damaging	0.89
R8410:Vmn2r102	UTSW	17	19677934	missense	possibly damaging	0.85
R9045:Vmn2r102	UTSW	17	19660579	missense	probably benign	0.00
R9267:Vmn2r102	UTSW	17	19676666	missense	probably damaging	1.00
R9325:Vmn2r102	UTSW	17	19677296	missense	probably damaging	1.00
R9363:Vmn2r102	UTSW	17	19677352	missense	probably benign	0.04
R9524:Vmn2r102	UTSW	17	19677302	missense	possibly damaging	0.74
R9747:Vmn2r102	UTSW	17	19677867	missense	probably benign	0.00
Z1176:Vmn2r102	UTSW	17	19694043	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGTAAAGGAGCTTACCTAAACC -3'
(R):5'- TGAGTGCAGCAGTGAAATTTC -3'

Sequencing Primer
(F):5'- AGGAGCTTACCTAAACCTATTTACC -3'
(R):5'- GCAGCAGTGAAATTTCTCTTTTTAC -3'

Posted On

2019-10-07