Incidental Mutation 'R7463:Cyp4f16'
ID578589
Institutional Source Beutler Lab
Gene Symbol Cyp4f16
Ensembl Gene ENSMUSG00000048440
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32536558-32551798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32550787 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 457 (A457V)
Ref Sequence ENSEMBL: ENSMUSP00000003416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003416] [ENSMUST00000165515] [ENSMUST00000169252] [ENSMUST00000169591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003416
AA Change: A457V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003416
Gene: ENSMUSG00000048440
AA Change: A457V

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165515
SMART Domains Protein: ENSMUSP00000126845
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169252
SMART Domains Protein: ENSMUSP00000128349
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169591
AA Change: A457V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131058
Gene: ENSMUSG00000048440
AA Change: A457V

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Meta Mutation Damage Score 0.5064 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Cyp4f16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02941:Cyp4f16 APN 17 32537087 missense possibly damaging 0.75
IGL03400:Cyp4f16 APN 17 32550353 missense probably benign 0.00
R0437:Cyp4f16 UTSW 17 32537098 missense possibly damaging 0.46
R0454:Cyp4f16 UTSW 17 32537087 missense probably damaging 0.97
R0482:Cyp4f16 UTSW 17 32550551 missense probably damaging 1.00
R1422:Cyp4f16 UTSW 17 32542999 missense probably damaging 0.99
R1435:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1440:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1616:Cyp4f16 UTSW 17 32542968 nonsense probably null
R1840:Cyp4f16 UTSW 17 32543006 critical splice donor site probably null
R1854:Cyp4f16 UTSW 17 32537099 missense probably damaging 0.99
R1912:Cyp4f16 UTSW 17 32545044 missense probably damaging 0.99
R2200:Cyp4f16 UTSW 17 32537104 missense probably damaging 0.98
R3803:Cyp4f16 UTSW 17 32544884 missense possibly damaging 0.96
R4811:Cyp4f16 UTSW 17 32545106 missense probably benign
R4812:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R4837:Cyp4f16 UTSW 17 32542764 missense possibly damaging 0.59
R4867:Cyp4f16 UTSW 17 32550750 missense possibly damaging 0.94
R4909:Cyp4f16 UTSW 17 32550321 missense possibly damaging 0.46
R5857:Cyp4f16 UTSW 17 32537024 missense probably damaging 1.00
R5986:Cyp4f16 UTSW 17 32544142 missense probably benign 0.45
R6013:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R6408:Cyp4f16 UTSW 17 32551199 missense probably damaging 1.00
R6651:Cyp4f16 UTSW 17 32544144 missense probably benign 0.00
R7923:Cyp4f16 UTSW 17 32546747 missense possibly damaging 0.67
RF005:Cyp4f16 UTSW 17 32545195 splice site probably null
X0017:Cyp4f16 UTSW 17 32544936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATCCATCAGTCTGGCCAG -3'
(R):5'- AACTTCCAACCCTGGGTTCTG -3'

Sequencing Primer
(F):5'- TCCAGGCATTGCTGGGAG -3'
(R):5'- GCAGACTTTTGTGCATACTCTGAGC -3'
Posted On2019-10-07