Incidental Mutation 'R7463:Crem'
ID 578592
Institutional Source Beutler Lab
Gene Symbol Crem
Ensembl Gene ENSMUSG00000063889
Gene Name cAMP responsive element modulator
Synonyms ICER
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 3266048-3337748 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3295094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 112 (I112V)
Ref Sequence ENSEMBL: ENSMUSP00000121118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025069] [ENSMUST00000082141] [ENSMUST00000122958] [ENSMUST00000123672] [ENSMUST00000126578] [ENSMUST00000129435] [ENSMUST00000130455] [ENSMUST00000130599] [ENSMUST00000131899] [ENSMUST00000134027] [ENSMUST00000136961] [ENSMUST00000137568] [ENSMUST00000142690] [ENSMUST00000144496] [ENSMUST00000146265] [ENSMUST00000148305] [ENSMUST00000149803] [ENSMUST00000150235] [ENSMUST00000151311] [ENSMUST00000152108] [ENSMUST00000152900] [ENSMUST00000154135] [ENSMUST00000154470] [ENSMUST00000154715] [ENSMUST00000156234] [ENSMUST00000165086]
AlphaFold P27699
Predicted Effect probably benign
Transcript: ENSMUST00000025069
AA Change: I165V

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025069
Gene: ENSMUSG00000063889
AA Change: I165V

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 3.1e-20 PFAM
BRLZ 285 343 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082141
AA Change: I116V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080780
Gene: ENSMUSG00000063889
AA Change: I116V

DomainStartEndE-ValueType
Pfam:pKID 63 104 2.6e-20 PFAM
BRLZ 248 306 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122958
AA Change: I112V

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121118
Gene: ENSMUSG00000063889
AA Change: I112V

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 301 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123672
AA Change: I100V

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120557
Gene: ENSMUSG00000063889
AA Change: I100V

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.5e-20 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126578
AA Change: I112V

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114780
Gene: ENSMUSG00000063889
AA Change: I112V

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 302 3.8e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118649
Gene: ENSMUSG00000063889
AA Change: I150V

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:pKID 98 139 3.1e-21 PFAM
BRLZ 271 328 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129435
AA Change: I63V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117438
Gene: ENSMUSG00000063889
AA Change: I63V

DomainStartEndE-ValueType
Pfam:pKID 10 51 5.6e-21 PFAM
BRLZ 183 240 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130455
AA Change: I155V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121541
Gene: ENSMUSG00000063889
AA Change: I155V

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.8e-20 PFAM
BRLZ 275 333 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130599
AA Change: I100V

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115471
Gene: ENSMUSG00000063889
AA Change: I100V

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.6e-20 PFAM
BRLZ 169 226 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131899
AA Change: I155V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119353
Gene: ENSMUSG00000063889
AA Change: I155V

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.2e-20 PFAM
BRLZ 224 282 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134027
Predicted Effect possibly damaging
Transcript: ENSMUST00000136961
AA Change: I88V

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115363
Gene: ENSMUSG00000063889
AA Change: I88V

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.5e-21 PFAM
BRLZ 208 265 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137568
AA Change: I106V

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115336
Gene: ENSMUSG00000063889
AA Change: I106V

DomainStartEndE-ValueType
Pfam:pKID 53 94 1.5e-20 PFAM
BRLZ 163 221 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142690
AA Change: I149V

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122282
Gene: ENSMUSG00000063889
AA Change: I149V

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 138 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144496
AA Change: I88V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120349
Gene: ENSMUSG00000063889
AA Change: I88V

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.9e-21 PFAM
BRLZ 220 277 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146265
AA Change: I155V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119638
Gene: ENSMUSG00000063889
AA Change: I155V

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.1e-20 PFAM
BRLZ 212 269 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148305
Predicted Effect probably benign
Transcript: ENSMUST00000149803
AA Change: I100V

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121210
Gene: ENSMUSG00000063889
AA Change: I100V

DomainStartEndE-ValueType
Pfam:pKID 47 89 2.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150235
AA Change: I165V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121233
Gene: ENSMUSG00000063889
AA Change: I165V

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 1.1e-20 PFAM
BRLZ 297 354 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151311
AA Change: I116V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118267
Gene: ENSMUSG00000063889
AA Change: I116V

DomainStartEndE-ValueType
Pfam:pKID 63 104 7.5e-21 PFAM
BRLZ 236 293 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152108
AA Change: I88V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122241
Gene: ENSMUSG00000063889
AA Change: I88V

DomainStartEndE-ValueType
Pfam:pKID 35 76 4.7e-21 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152900
AA Change: I106V

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123515
Gene: ENSMUSG00000063889
AA Change: I106V

DomainStartEndE-ValueType
Pfam:pKID 53 94 2.4e-20 PFAM
BRLZ 238 296 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154135
AA Change: I116V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122051
Gene: ENSMUSG00000063889
AA Change: I116V

DomainStartEndE-ValueType
Pfam:pKID 63 104 1.9e-20 PFAM
BRLZ 185 243 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154470
AA Change: I165V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118128
Gene: ENSMUSG00000063889
AA Change: I165V

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.3e-20 PFAM
BRLZ 222 280 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154715
AA Change: I137V

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122179
Gene: ENSMUSG00000063889
AA Change: I137V

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
Pfam:pKID 84 125 8.7e-21 PFAM
BRLZ 269 327 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156234
AA Change: I149V

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121388
Gene: ENSMUSG00000063889
AA Change: I149V

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 137 9.1e-21 PFAM
BRLZ 281 339 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165086
AA Change: I165V

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127353
Gene: ENSMUSG00000063889
AA Change: I165V

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.4e-20 PFAM
BRLZ 234 292 3.8e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygotes for targeted mutations exhibit reduced regenerative capacity after partial hepatectomy and reduced cardiac function. Males are sterile due to a block in spermiogenesis associated with a lack of postmeiotic gene expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Crem
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Crem APN 18 3299236 missense probably damaging 1.00
IGL01532:Crem APN 18 3276732 missense probably benign 0.02
IGL02500:Crem APN 18 3273477 missense probably damaging 1.00
IGL03280:Crem APN 18 3273415 splice site probably benign
menthe UTSW 18 3268070 missense probably damaging 1.00
R0379:Crem UTSW 18 3299226 missense probably damaging 1.00
R0987:Crem UTSW 18 3288060 missense probably damaging 0.98
R1829:Crem UTSW 18 3295037 splice site probably null
R1932:Crem UTSW 18 3299284 missense probably benign 0.27
R2086:Crem UTSW 18 3288098 intron probably benign
R2093:Crem UTSW 18 3299256 missense probably damaging 1.00
R4152:Crem UTSW 18 3288055 missense probably damaging 0.99
R4568:Crem UTSW 18 3299175 missense probably damaging 0.98
R4758:Crem UTSW 18 3327527 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6445:Crem UTSW 18 3309671 missense probably benign
R6525:Crem UTSW 18 3268070 missense probably damaging 1.00
R6651:Crem UTSW 18 3325428 missense probably benign 0.18
R7035:Crem UTSW 18 3327503 missense probably damaging 1.00
R7137:Crem UTSW 18 3273459 missense possibly damaging 0.89
R7401:Crem UTSW 18 3295329 missense probably damaging 1.00
R7516:Crem UTSW 18 3299141 splice site probably null
R8095:Crem UTSW 18 3295106 missense probably benign 0.00
R8146:Crem UTSW 18 3288007 missense possibly damaging 0.68
R8266:Crem UTSW 18 3309535 intron probably benign
R8308:Crem UTSW 18 3295397 missense possibly damaging 0.55
R8825:Crem UTSW 18 3268061 missense probably damaging 0.99
R8899:Crem UTSW 18 3295370 missense probably damaging 0.99
R8976:Crem UTSW 18 3268088 missense possibly damaging 0.88
Z1176:Crem UTSW 18 3267730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTAACGATGCACAGCTG -3'
(R):5'- AAGACCCTCATATAGGTGAGTTAAC -3'

Sequencing Primer
(F):5'- CTGTTAATGAAACATTCGGATGCCC -3'
(R):5'- GGTGAGTTAACTAACTTTCCAACTTG -3'
Posted On 2019-10-07