Incidental Mutation 'R7463:Zfp516'
ID578594
Institutional Source Beutler Lab
Gene Symbol Zfp516
Ensembl Gene ENSMUSG00000058881
Gene Namezinc finger protein 516
SynonymsC330029B10Rik, Zfp26l
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R7463 (G1)
Quality Score197.009
Status Validated
Chromosome18
Chromosomal Location82910879-83005314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82957108 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 477 (M477K)
Ref Sequence ENSEMBL: ENSMUSP00000126629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]
Predicted Effect probably benign
Transcript: ENSMUST00000071233
AA Change: M477K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: M477K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171238
AA Change: M477K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: M477K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Other mutations in Zfp516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Zfp516 APN 18 82957108 missense probably benign 0.08
IGL01343:Zfp516 APN 18 82993096 missense probably damaging 0.99
IGL01413:Zfp516 APN 18 82987670 nonsense probably null
IGL01684:Zfp516 APN 18 82957201 missense probably damaging 1.00
IGL01820:Zfp516 APN 18 82987361 missense probably benign 0.00
IGL02081:Zfp516 APN 18 82955733 missense probably benign 0.00
IGL02209:Zfp516 APN 18 82994497 missense probably benign
IGL02253:Zfp516 APN 18 82994497 missense probably benign
IGL03028:Zfp516 APN 18 82955913 missense possibly damaging 0.95
IGL03241:Zfp516 APN 18 82987520 missense probably benign 0.01
R0379:Zfp516 UTSW 18 82987670 nonsense probably null
R0426:Zfp516 UTSW 18 82955772 missense probably benign 0.04
R0466:Zfp516 UTSW 18 82957454 splice site probably null
R0715:Zfp516 UTSW 18 82987263 missense probably damaging 1.00
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R2110:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2112:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2162:Zfp516 UTSW 18 82986938 missense possibly damaging 0.95
R2223:Zfp516 UTSW 18 82955770 missense possibly damaging 0.94
R4097:Zfp516 UTSW 18 82987256 missense possibly damaging 0.95
R4299:Zfp516 UTSW 18 82987497 missense possibly damaging 0.80
R4378:Zfp516 UTSW 18 82987180 missense probably benign 0.00
R4601:Zfp516 UTSW 18 82956039 missense probably benign 0.14
R4721:Zfp516 UTSW 18 82957111 missense possibly damaging 0.49
R4946:Zfp516 UTSW 18 82956094 missense probably benign 0.06
R5186:Zfp516 UTSW 18 82957093 missense probably benign
R5351:Zfp516 UTSW 18 82956751 missense probably benign 0.00
R5937:Zfp516 UTSW 18 82956833 missense probably damaging 0.99
R5998:Zfp516 UTSW 18 82956514 missense probably damaging 1.00
R6458:Zfp516 UTSW 18 82987350 missense probably benign 0.03
R6513:Zfp516 UTSW 18 82955710 missense probably damaging 1.00
R6626:Zfp516 UTSW 18 82988107 missense probably damaging 1.00
R6712:Zfp516 UTSW 18 82957308 missense probably damaging 1.00
R6877:Zfp516 UTSW 18 82955791 missense probably damaging 1.00
R6886:Zfp516 UTSW 18 82957000 missense probably benign 0.06
R7073:Zfp516 UTSW 18 82988200 critical splice donor site probably null
R7863:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R8097:Zfp516 UTSW 18 82987170 nonsense probably null
R8244:Zfp516 UTSW 18 82956333 missense probably damaging 1.00
R8245:Zfp516 UTSW 18 82956333 missense probably damaging 1.00
R8362:Zfp516 UTSW 18 82986894 missense probably benign 0.01
R8410:Zfp516 UTSW 18 82956333 missense probably damaging 1.00
X0019:Zfp516 UTSW 18 82987488 missense probably damaging 1.00
X0065:Zfp516 UTSW 18 82987169 missense probably damaging 1.00
Z1176:Zfp516 UTSW 18 82987533 missense probably benign 0.01
Z1177:Zfp516 UTSW 18 82956066 missense probably damaging 1.00
Z1177:Zfp516 UTSW 18 82956067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTCAAGTACGGGACCTG -3'
(R):5'- CTACACGGGGTACTTGAACC -3'

Sequencing Primer
(F):5'- CAAGTACGGGACCTGGGACG -3'
(R):5'- GGGTACTTGAACCTCATCCG -3'
Posted On2019-10-07