Incidental Mutation 'R7463:Ermp1'
ID578595
Institutional Source Beutler Lab
Gene Symbol Ermp1
Ensembl Gene ENSMUSG00000046324
Gene Nameendoplasmic reticulum metallopeptidase 1
SynonymsD19Ertd410e, D19Wsu12e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29608214-29648415 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 29646262 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 109 (Y109*)
Ref Sequence ENSEMBL: ENSMUSP00000124881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054083] [ENSMUST00000159692] [ENSMUST00000162534]
Predicted Effect probably null
Transcript: ENSMUST00000054083
AA Change: Y53*
SMART Domains Protein: ENSMUSP00000057069
Gene: ENSMUSG00000046324
AA Change: Y53*

DomainStartEndE-ValueType
SCOP:d1amp__ 31 159 3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159692
AA Change: Y109*
SMART Domains Protein: ENSMUSP00000124881
Gene: ENSMUSG00000046324
AA Change: Y109*

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 65 94 N/A INTRINSIC
Pfam:Peptidase_M28 179 373 1.3e-49 PFAM
Pfam:Peptidase_M20 184 375 2.9e-8 PFAM
transmembrane domain 405 427 N/A INTRINSIC
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 481 503 N/A INTRINSIC
transmembrane domain 516 538 N/A INTRINSIC
transmembrane domain 543 562 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162534
SMART Domains Protein: ENSMUSP00000124992
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
Pfam:Peptidase_M28 5 176 2.4e-40 PFAM
Pfam:Peptidase_M20 8 168 1.3e-8 PFAM
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 257 279 N/A INTRINSIC
transmembrane domain 294 316 N/A INTRINSIC
transmembrane domain 329 351 N/A INTRINSIC
transmembrane domain 356 375 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including double outlet right ventricle, aortic arch anomalies and vascular ring, as well as anopthalmia, renal dysplasia, and craniofacial anomalies including short snout, cleft palate and cleft lip. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Ermp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Ermp1 APN 19 29639939 missense probably damaging 1.00
IGL01696:Ermp1 APN 19 29646138 missense possibly damaging 0.65
IGL01759:Ermp1 APN 19 29615836 missense probably benign 0.03
IGL01891:Ermp1 APN 19 29616602 missense probably benign 0.16
IGL02008:Ermp1 APN 19 29612920 missense probably damaging 1.00
IGL02034:Ermp1 APN 19 29645959 splice site probably benign
IGL02655:Ermp1 APN 19 29646210 nonsense probably null
IGL03074:Ermp1 APN 19 29612535 missense probably damaging 1.00
PIT4366001:Ermp1 UTSW 19 29628789 missense probably benign 0.24
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0361:Ermp1 UTSW 19 29631406 missense probably damaging 1.00
R0684:Ermp1 UTSW 19 29632541 splice site probably benign
R0711:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R1167:Ermp1 UTSW 19 29628679 missense possibly damaging 0.53
R1869:Ermp1 UTSW 19 29646015 missense possibly damaging 0.66
R1884:Ermp1 UTSW 19 29616679 missense probably benign 0.00
R2094:Ermp1 UTSW 19 29639928 missense probably benign 0.09
R2135:Ermp1 UTSW 19 29646065 missense possibly damaging 0.81
R2153:Ermp1 UTSW 19 29637398 critical splice acceptor site probably null
R2290:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R4176:Ermp1 UTSW 19 29645965 critical splice donor site probably null
R4363:Ermp1 UTSW 19 29612876 missense probably damaging 1.00
R4579:Ermp1 UTSW 19 29616651 missense probably damaging 0.98
R4761:Ermp1 UTSW 19 29646256 missense probably benign 0.03
R5801:Ermp1 UTSW 19 29612828 missense probably damaging 1.00
R5931:Ermp1 UTSW 19 29615729 missense probably benign 0.01
R6129:Ermp1 UTSW 19 29623209 missense possibly damaging 0.95
R6556:Ermp1 UTSW 19 29612921 missense possibly damaging 0.91
R6563:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R6598:Ermp1 UTSW 19 29632502 missense possibly damaging 0.82
R6647:Ermp1 UTSW 19 29626935 missense probably benign 0.27
R6850:Ermp1 UTSW 19 29616641 missense probably damaging 1.00
R6912:Ermp1 UTSW 19 29616611 missense probably benign 0.02
R7341:Ermp1 UTSW 19 29646254 missense probably benign 0.20
R7391:Ermp1 UTSW 19 29627068 critical splice acceptor site probably null
R7391:Ermp1 UTSW 19 29627069 critical splice acceptor site probably null
R7471:Ermp1 UTSW 19 29612654 missense probably benign 0.06
R7831:Ermp1 UTSW 19 29617967 missense probably benign 0.00
R7836:Ermp1 UTSW 19 29632388 splice site probably null
R7923:Ermp1 UTSW 19 29628658 missense probably benign 0.01
R8113:Ermp1 UTSW 19 29615796 missense probably benign 0.00
R8116:Ermp1 UTSW 19 29623796 missense probably damaging 0.98
Z1088:Ermp1 UTSW 19 29612925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCCAGCTTTACCACGACATTAG -3'
(R):5'- CCAGATCTCAAGAGTTAGAGGTGG -3'

Sequencing Primer
(F):5'- CCAGCTTTACCACGACATTAGTAATG -3'
(R):5'- TGGAAGAGAGGCACAGTGATTTTC -3'
Posted On2019-10-07