Incidental Mutation 'R7463:Acta2'
ID 578596
Institutional Source Beutler Lab
Gene Symbol Acta2
Ensembl Gene ENSMUSG00000035783
Gene Name actin alpha 2, smooth muscle, aorta
Synonyms Actvs, alphaSMA, SMalphaA, SMAalpha, 0610041G09Rik, a-SMA
MMRRC Submission 045537-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.227) question?
Stock # R7463 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34218490-34232990 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34229931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 8 (T8I)
Ref Sequence ENSEMBL: ENSMUSP00000048218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631]
AlphaFold P62737
Predicted Effect probably benign
Transcript: ENSMUST00000039631
AA Change: T8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783
AA Change: T8I

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vascular contractility and blood pressure homeostasis, increased blood-retina barrier permeability, and reduced retinal cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,634,698 (GRCm39) V435E probably damaging Het
Adcy2 T C 13: 68,878,399 (GRCm39) D413G probably damaging Het
Adgrg6 T A 10: 14,310,140 (GRCm39) D727V possibly damaging Het
Aebp2 C T 6: 140,583,452 (GRCm39) Q309* probably null Het
Amy1 A T 3: 113,363,533 (GRCm39) C43* probably null Het
Bpifc T C 10: 85,815,198 (GRCm39) E256G probably benign Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Carmil3 C T 14: 55,739,853 (GRCm39) P980L probably damaging Het
Coch T A 12: 51,640,408 (GRCm39) M1K probably null Het
Cpt2 A T 4: 107,765,354 (GRCm39) F137I probably damaging Het
Crem T C 18: 3,295,094 (GRCm39) I112V probably benign Het
Cul9 A G 17: 46,831,402 (GRCm39) probably null Het
Cyp3a41a T A 5: 145,650,374 (GRCm39) I90F probably damaging Het
Cyp4f16 C T 17: 32,769,761 (GRCm39) A457V possibly damaging Het
Ddx6 A G 9: 44,540,026 (GRCm39) E318G probably damaging Het
Dip2b A G 15: 100,052,038 (GRCm39) E213G probably benign Het
Dlx5 T C 6: 6,878,316 (GRCm39) H238R probably damaging Het
Dnai2 A C 11: 114,645,232 (GRCm39) I556L probably benign Het
Dnmt1 C T 9: 20,823,521 (GRCm39) V1147M possibly damaging Het
Egf G T 3: 129,533,664 (GRCm39) Q59K probably benign Het
Ermp1 A T 19: 29,623,662 (GRCm39) Y109* probably null Het
Fer1l6 T A 15: 58,445,450 (GRCm39) Y573* probably null Het
Fmnl1 T C 11: 103,083,954 (GRCm39) L503P probably damaging Het
Gnptab T G 10: 88,267,251 (GRCm39) I447M probably damaging Het
Hgf G A 5: 16,783,448 (GRCm39) D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Igf2r T C 17: 12,929,532 (GRCm39) T958A probably benign Het
Kcnd2 T A 6: 21,216,497 (GRCm39) L67Q probably damaging Het
Kif5a A G 10: 127,079,593 (GRCm39) V248A probably damaging Het
Krt33b A G 11: 99,920,389 (GRCm39) I88T probably damaging Het
Lhx2 G A 2: 38,241,858 (GRCm39) E25K possibly damaging Het
Mex3d C T 10: 80,217,532 (GRCm39) G562R Het
Myom2 A T 8: 15,167,679 (GRCm39) Y1088F probably null Het
Ncapg T A 5: 45,851,434 (GRCm39) probably null Het
Nudc A C 4: 133,261,714 (GRCm39) V190G possibly damaging Het
Obscn G T 11: 59,013,686 (GRCm39) R1054S probably benign Het
Or10g1 A G 14: 52,648,168 (GRCm39) W54R probably benign Het
Or10g9 A G 9: 39,911,860 (GRCm39) V221A probably benign Het
Or2d4 A T 7: 106,543,380 (GRCm39) V276E probably damaging Het
Or52h9 T C 7: 104,202,689 (GRCm39) S188P possibly damaging Het
Or56a5 T A 7: 104,793,144 (GRCm39) M119L probably benign Het
Or8j3 T C 2: 86,028,182 (GRCm39) M305V probably benign Het
Pcdh10 A T 3: 45,338,007 (GRCm39) R891S possibly damaging Het
Pcdh15 C T 10: 74,467,602 (GRCm39) S1873L possibly damaging Het
Pcdh7 A G 5: 57,878,340 (GRCm39) K632E probably benign Het
Pcdhgb8 G A 18: 37,896,480 (GRCm39) A517T probably damaging Het
Ptgr2 A T 12: 84,339,072 (GRCm39) probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Racgap1 T A 15: 99,540,839 (GRCm39) T4S probably benign Het
Rb1cc1 A G 1: 6,319,404 (GRCm39) H941R probably benign Het
Reln T C 5: 22,308,433 (GRCm39) H312R probably damaging Het
Rnf166 T A 8: 123,194,726 (GRCm39) H208L probably damaging Het
Spmap2 T C 10: 79,412,549 (GRCm39) E314G probably damaging Het
Timeless T C 10: 128,086,295 (GRCm39) S999P probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tor1aip1 A T 1: 155,883,355 (GRCm39) H349Q possibly damaging Het
Ttn T A 2: 76,750,804 (GRCm39) E3415V probably benign Het
Vmn2r102 A T 17: 19,896,886 (GRCm39) N78Y probably damaging Het
Wdr11 A T 7: 129,208,810 (GRCm39) D427V probably damaging Het
Zer1 A T 2: 30,003,449 (GRCm39) probably benign Het
Zfp516 T A 18: 82,975,233 (GRCm39) M477K probably benign Het
Other mutations in Acta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Acta2 APN 19 34,229,191 (GRCm39) missense probably damaging 0.98
IGL01802:Acta2 APN 19 34,220,836 (GRCm39) missense possibly damaging 0.91
IGL01945:Acta2 APN 19 34,229,254 (GRCm39) missense probably benign 0.03
IGL02136:Acta2 APN 19 34,229,230 (GRCm39) missense probably damaging 1.00
IGL03114:Acta2 APN 19 34,222,310 (GRCm39) critical splice donor site probably null
R0648:Acta2 UTSW 19 34,225,934 (GRCm39) missense probably benign
R1393:Acta2 UTSW 19 34,219,192 (GRCm39) missense probably damaging 1.00
R1597:Acta2 UTSW 19 34,229,983 (GRCm39) splice site probably benign
R2045:Acta2 UTSW 19 34,220,799 (GRCm39) missense probably damaging 1.00
R2338:Acta2 UTSW 19 34,225,941 (GRCm39) splice site probably benign
R3113:Acta2 UTSW 19 34,220,752 (GRCm39) missense probably benign
R3940:Acta2 UTSW 19 34,220,880 (GRCm39) missense possibly damaging 0.94
R3955:Acta2 UTSW 19 34,229,126 (GRCm39) splice site probably benign
R4765:Acta2 UTSW 19 34,223,552 (GRCm39) missense probably damaging 1.00
R4826:Acta2 UTSW 19 34,229,223 (GRCm39) nonsense probably null
R6453:Acta2 UTSW 19 34,224,057 (GRCm39) missense probably damaging 1.00
R6754:Acta2 UTSW 19 34,222,383 (GRCm39) missense probably damaging 1.00
R6941:Acta2 UTSW 19 34,229,922 (GRCm39) missense probably damaging 1.00
R7311:Acta2 UTSW 19 34,219,186 (GRCm39) missense probably damaging 1.00
R7461:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7464:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7536:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7537:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7605:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7609:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7610:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7611:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7613:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7626:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7627:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7803:Acta2 UTSW 19 34,220,818 (GRCm39) missense probably benign
R7872:Acta2 UTSW 19 34,220,839 (GRCm39) missense probably damaging 0.99
R8801:Acta2 UTSW 19 34,229,207 (GRCm39) missense probably damaging 0.99
R9059:Acta2 UTSW 19 34,219,155 (GRCm39) missense possibly damaging 0.87
R9191:Acta2 UTSW 19 34,222,480 (GRCm39) missense possibly damaging 0.82
R9487:Acta2 UTSW 19 34,225,865 (GRCm39) missense probably damaging 0.99
R9675:Acta2 UTSW 19 34,223,612 (GRCm39) missense
R9776:Acta2 UTSW 19 34,223,481 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGACACAGAGGGATCTAGCC -3'
(R):5'- CGGATCATCAAAGGCTTTACAGC -3'

Sequencing Primer
(F):5'- AGGGATCTAGCCTAAAGTCTTGTCC -3'
(R):5'- GCTTTACAGCCTAGTGAAAGC -3'
Posted On 2019-10-07