Incidental Mutation 'R7464:Ptpn18'
ID578598
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Nameprotein tyrosine phosphatase, non-receptor type 18
SynonymsPTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34459762-34475733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34473364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 417 (D417N)
Ref Sequence ENSEMBL: ENSMUSP00000027302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027302
AA Change: D417N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: D417N

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188972
AA Change: D68N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000190122
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34463119 missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34459817 utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34471908 missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34470257 unclassified probably null
R0848:Ptpn18 UTSW 1 34462702 missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34463506 critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34463109 missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34470219 missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34471661 missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34471692 nonsense probably null
R4061:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34462742 missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34472960 missense probably benign
R4626:Ptpn18 UTSW 1 34471792 intron probably null
R4978:Ptpn18 UTSW 1 34469813 intron probably benign
R5260:Ptpn18 UTSW 1 34463510 splice site probably benign
R5335:Ptpn18 UTSW 1 34463178 missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34471663 missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34471563 splice site probably benign
R7038:Ptpn18 UTSW 1 34459825 start codon destroyed probably null 1.00
R7225:Ptpn18 UTSW 1 34472846 missense possibly damaging 0.58
R7290:Ptpn18 UTSW 1 34462811 critical splice donor site probably null
R7411:Ptpn18 UTSW 1 34472192 critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34473335 missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34462750 missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7463:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7899:Ptpn18 UTSW 1 34469905 splice site probably null
X0065:Ptpn18 UTSW 1 34469891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTCCGAACTTGGACAC -3'
(R):5'- GATGCGCAAGTTGAAGCCTAAG -3'

Sequencing Primer
(F):5'- AACTTGGACACGCCCATGG -3'
(R):5'- GGCTCCATGCAGAAGCTAAG -3'
Posted On2019-10-07