Incidental Mutation 'R7464:Gigyf2'
ID578601
Institutional Source Beutler Lab
Gene Symbol Gigyf2
Ensembl Gene ENSMUSG00000048000
Gene NameGRB10 interacting GYF protein 2
Synonyms2610016F01Rik, Tnrc15, A830080H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87326998-87450796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87428604 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 803 (I803T)
Ref Sequence ENSEMBL: ENSMUSP00000027475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000164992] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173173] [ENSMUST00000174501]
Predicted Effect unknown
Transcript: ENSMUST00000027475
AA Change: I803T
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000
AA Change: I803T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164992
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172794
AA Change: I797T
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000
AA Change: I797T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172964
AA Change: I803T
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000
AA Change: I803T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173173
AA Change: I796T
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000
AA Change: I796T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134677
Gene: ENSMUSG00000048000
AA Change: I624T

DomainStartEndE-ValueType
low complexity region 69 107 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
internal_repeat_1 166 206 3.2e-5 PROSPERO
internal_repeat_1 226 262 3.2e-5 PROSPERO
GYF 357 412 2.83e-26 SMART
low complexity region 442 489 N/A INTRINSIC
coiled coil region 544 745 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174501
AA Change: I803T
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000
AA Change: I803T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains CAG trinucleotide repeats and encodes a protein containing several stretches of polyglutamine residues. The encoded protein may be involved in the regulation of tyrosine kinase receptor signaling. This gene is located in a chromosomal region that was genetically linked to Parkinson disease type 11, and mutations in this gene were thought to be causative for this disease. However, more recent studies in different populations have been unable to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal and postnatal lethality. Mice heterozygous for a knock-out allele exhibit impaired motor coordination with motor neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Gigyf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gigyf2 APN 1 87436850 missense probably damaging 0.99
IGL01828:Gigyf2 APN 1 87419098 missense probably damaging 1.00
IGL02222:Gigyf2 APN 1 87410863 splice site probably null
IGL02259:Gigyf2 APN 1 87411837 missense probably damaging 1.00
IGL02562:Gigyf2 APN 1 87407375 missense probably benign 0.15
IGL02565:Gigyf2 APN 1 87442136 missense probably damaging 1.00
IGL02695:Gigyf2 APN 1 87416827 missense probably benign 0.07
IGL03264:Gigyf2 APN 1 87449068 splice site probably benign
Flop UTSW 1 87365266 missense probably damaging 1.00
FR4449:Gigyf2 UTSW 1 87428585 unclassified probably benign
PIT4260001:Gigyf2 UTSW 1 87419106 missense unknown
R0041:Gigyf2 UTSW 1 87378976 missense probably damaging 1.00
R0126:Gigyf2 UTSW 1 87411875 splice site probably benign
R0190:Gigyf2 UTSW 1 87428688 unclassified probably benign
R0244:Gigyf2 UTSW 1 87379015 missense possibly damaging 0.96
R0492:Gigyf2 UTSW 1 87440846 missense probably damaging 1.00
R0526:Gigyf2 UTSW 1 87421493 missense probably benign 0.00
R0612:Gigyf2 UTSW 1 87449080 missense probably damaging 1.00
R0731:Gigyf2 UTSW 1 87407727 splice site probably benign
R0783:Gigyf2 UTSW 1 87407161 missense probably damaging 0.99
R1445:Gigyf2 UTSW 1 87443638 splice site probably benign
R1620:Gigyf2 UTSW 1 87449128 missense probably damaging 1.00
R1678:Gigyf2 UTSW 1 87416983 missense probably benign 0.44
R2008:Gigyf2 UTSW 1 87374113 critical splice donor site probably null
R2111:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2112:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2180:Gigyf2 UTSW 1 87416920 missense probably damaging 1.00
R3438:Gigyf2 UTSW 1 87440580 missense probably damaging 0.96
R3690:Gigyf2 UTSW 1 87421516 missense possibly damaging 0.80
R4089:Gigyf2 UTSW 1 87443672 missense probably damaging 1.00
R4411:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4412:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4489:Gigyf2 UTSW 1 87440826 missense probably damaging 1.00
R4743:Gigyf2 UTSW 1 87365248 nonsense probably null
R4769:Gigyf2 UTSW 1 87440849 missense probably damaging 1.00
R4854:Gigyf2 UTSW 1 87354413 unclassified probably benign
R5215:Gigyf2 UTSW 1 87365266 missense probably damaging 1.00
R5326:Gigyf2 UTSW 1 87425138 unclassified probably benign
R5771:Gigyf2 UTSW 1 87446328 missense possibly damaging 0.90
R5813:Gigyf2 UTSW 1 87440763 missense probably damaging 0.99
R5964:Gigyf2 UTSW 1 87407167 missense probably damaging 1.00
R6026:Gigyf2 UTSW 1 87440732 missense probably damaging 0.99
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6784:Gigyf2 UTSW 1 87443674 missense probably damaging 1.00
R6800:Gigyf2 UTSW 1 87419176 missense possibly damaging 0.68
R6991:Gigyf2 UTSW 1 87407136 missense probably damaging 1.00
R7224:Gigyf2 UTSW 1 87403725 missense unknown
R7554:Gigyf2 UTSW 1 87407570 missense unknown
R7658:Gigyf2 UTSW 1 87419138 missense unknown
R7976:Gigyf2 UTSW 1 87403736 missense unknown
R8032:Gigyf2 UTSW 1 87407013 missense unknown
R8070:Gigyf2 UTSW 1 87440907 missense probably benign 0.03
R8071:Gigyf2 UTSW 1 87446433 missense probably damaging 0.99
X0065:Gigyf2 UTSW 1 87411867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTCCATATCTGCGCCTAG -3'
(R):5'- TGAGAAGGTGTCAGTAGCTGCC -3'

Sequencing Primer
(F):5'- GGATTAAAGTGTGCCACCATACCTG -3'
(R):5'- TGTCAGTAGCTGCCCCTGC -3'
Posted On2019-10-07