Incidental Mutation 'R7464:Pkp4'
ID578607
Institutional Source Beutler Lab
Gene Symbol Pkp4
Ensembl Gene ENSMUSG00000026991
Gene Nameplakophilin 4
SynonymsArmrp, 9430019K17Rik, 5031422I09Rik, p0071
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7464 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location59160850-59355208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59308137 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 244 (F244I)
Ref Sequence ENSEMBL: ENSMUSP00000099815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332] [ENSMUST00000184705]
Predicted Effect probably benign
Transcript: ENSMUST00000037903
AA Change: F244I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991
AA Change: F244I

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102754
AA Change: F244I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991
AA Change: F244I

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1083 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112577
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123908
AA Change: F244I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991
AA Change: F244I

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168631
AA Change: F244I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991
AA Change: F244I

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1041 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183359
SMART Domains Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184332
Predicted Effect probably benign
Transcript: ENSMUST00000184705
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Pkp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pkp4 APN 2 59338755 missense probably damaging 0.99
IGL00987:Pkp4 APN 2 59308357 missense probably damaging 0.98
IGL01321:Pkp4 APN 2 59350627 splice site probably null
IGL01393:Pkp4 APN 2 59347925 missense probably damaging 1.00
IGL02058:Pkp4 APN 2 59311729 nonsense probably null
IGL02313:Pkp4 APN 2 59310254 nonsense probably null
IGL02635:Pkp4 APN 2 59305498 unclassified probably benign
IGL03017:Pkp4 APN 2 59266425 missense probably benign 0.06
IGL03051:Pkp4 APN 2 59311762 missense probably benign 0.29
Degrasso UTSW 2 59318600 missense probably damaging 1.00
melted UTSW 2 59334932 critical splice donor site probably null
R0206:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0207:Pkp4 UTSW 2 59305488 missense possibly damaging 0.89
R0208:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0325:Pkp4 UTSW 2 59318529 missense probably damaging 1.00
R0620:Pkp4 UTSW 2 59322643 missense possibly damaging 0.46
R0781:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1110:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1537:Pkp4 UTSW 2 59214803 missense probably damaging 1.00
R1607:Pkp4 UTSW 2 59322554 missense probably benign 0.00
R1654:Pkp4 UTSW 2 59337619 missense probably damaging 0.96
R1760:Pkp4 UTSW 2 59311841 missense probably damaging 0.97
R2051:Pkp4 UTSW 2 59334904 missense probably benign 0.37
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R3161:Pkp4 UTSW 2 59308105 missense probably damaging 1.00
R4261:Pkp4 UTSW 2 59305162 missense probably damaging 1.00
R4342:Pkp4 UTSW 2 59350608 missense probably damaging 0.98
R4731:Pkp4 UTSW 2 59334932 critical splice donor site probably null
R4799:Pkp4 UTSW 2 59342105 missense probably damaging 1.00
R4913:Pkp4 UTSW 2 59305450 missense probably damaging 1.00
R5383:Pkp4 UTSW 2 59310273 nonsense probably null
R5418:Pkp4 UTSW 2 59310162 missense probably benign 0.09
R5906:Pkp4 UTSW 2 59305076 missense possibly damaging 0.79
R5946:Pkp4 UTSW 2 59305067 missense probably benign 0.01
R6360:Pkp4 UTSW 2 59214747 missense probably benign 0.01
R6616:Pkp4 UTSW 2 59350552 nonsense probably null
R6817:Pkp4 UTSW 2 59318600 missense probably damaging 1.00
R7390:Pkp4 UTSW 2 59310140 missense possibly damaging 0.94
R7408:Pkp4 UTSW 2 59311766 missense probably damaging 1.00
R7702:Pkp4 UTSW 2 59308413 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCCTGGATAAACCCGTTCTC -3'
(R):5'- TACTCGAGTCTGGGCATCAG -3'

Sequencing Primer
(F):5'- CTGGATAAACCCGTTCTCTTTTC -3'
(R):5'- AGTCTGGGCATCAGTCAGG -3'
Posted On2019-10-07