Incidental Mutation 'R7464:Baz2b'
ID578608
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59977448 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 156 (T156A)
Ref Sequence ENSEMBL: ENSMUSP00000088443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090925
AA Change: T156A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: T156A

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112550
AA Change: T156A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: T156A

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 unclassified probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 intron probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCGGGATTTAACTGGCCAAG -3'
(R):5'- ACAATGCATACCCTACTCCTTG -3'

Sequencing Primer
(F):5'- CGGGATTTAACTGGCCAAGACATC -3'
(R):5'- GTTCTGGCCAAATACTGTCCC -3'
Posted On2019-10-07