Mutagenetix > Incidental Mutations

Incidental Mutation 'R7464:Ubr1'

578610

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.830) question?

Stock #

R7464 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 120889774 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

Predicted Effect

probably null
Transcript: ENSMUST00000028728

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	C	T	6: 23,077,153	G736R	possibly damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Ankar	A	T	1: 72,698,894	V43E	possibly damaging	Het
Apof	A	G	10: 128,269,636	I220V	probably benign	Het
Asxl1	G	T	2: 153,397,785	A499S	probably benign	Het
Baz2a	T	A	10: 128,122,073	D1069E	possibly damaging	Het
Baz2b	T	C	2: 59,977,448	T156A	possibly damaging	Het
Bbc3	A	T	7: 16,317,157	R169W	unknown	Het
C5ar1	T	A	7: 16,248,766	I110L	probably benign	Het
C87414	C	T	5: 93,636,240	C455Y	probably damaging	Het
Cd19	C	A	7: 126,411,803	R323L	probably damaging	Het
Cdc14b	A	T	13: 64,196,675	C113*	probably null	Het
Cngb1	C	A	8: 95,254,183	W914L	possibly damaging	Het
Colgalt2	A	G	1: 152,504,144	K445E	probably damaging	Het
Crebrf	A	G	17: 26,763,487	M608V	unknown	Het
Csf1	T	A	3: 107,748,875	H280L	probably benign	Het
Cyp2j11	C	A	4: 96,345,120	R113L	probably damaging	Het
D5Ertd579e	G	A	5: 36,613,785	H1089Y	probably damaging	Het
Ddx60	C	T	8: 61,940,674	T48M	possibly damaging	Het
Dock10	T	C	1: 80,540,315	D1315G	probably damaging	Het
Dock2	T	G	11: 34,695,278	N526H	probably damaging	Het
Dram2	T	C	3: 106,573,683	*268Q	probably null	Het
Emc8	A	G	8: 120,667,918	Y21H	possibly damaging	Het
Fam162a	A	G	16: 36,071,493	L4P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbxw10	T	A	11: 62,853,298	I307N	probably benign	Het
Fbxw16	A	G	9: 109,439,551	V257A	possibly damaging	Het
Fer1l6	T	A	15: 58,573,247		probably null	Het
Galnt7	A	G	8: 57,584,020	Y112H	possibly damaging	Het
Gigyf2	T	C	1: 87,428,604	I803T	unknown	Het
Gm10696	A	T	3: 94,176,104	N133K	probably benign	Het
Gm15292	T	A	8: 21,249,894	S45T	probably damaging	Het
Gm28729	A	G	9: 96,521,235	I44T	possibly damaging	Het
Gm5447	A	G	13: 30,974,394	I34V	not run	Het
H2-M9	A	T	17: 36,642,411		probably null	Het
Helz	G	A	11: 107,636,278	C864Y	probably damaging	Het
Il25	A	G	14: 54,933,222	Y84C	probably null	Het
Itga10	T	A	3: 96,648,155	C142S	probably damaging	Het
Kcna10	A	T	3: 107,194,079	M9L	probably damaging	Het
Klhl6	G	T	16: 19,957,113	Q232K	possibly damaging	Het
Mb21d2	T	G	16: 28,929,546	I40L	possibly damaging	Het
Mdm1	T	C	10: 118,152,266	S334P	probably benign	Het
Mllt10	T	A	2: 18,170,279	D549E	probably benign	Het
Mlxipl	T	C	5: 135,133,628	V648A	probably benign	Het
Nars2	A	G	7: 97,039,930	K353R	probably benign	Het
Nav1	T	A	1: 135,584,909	M138L	probably benign	Het
Neb	T	C	2: 52,193,890	T5635A	probably benign	Het
Nktr	A	C	9: 121,750,327	I1154L	unknown	Het
Olfr1284	T	A	2: 111,379,198	L66Q	probably damaging	Het
Olfr47	T	G	6: 43,236,294	S229A	probably damaging	Het
Olfr761	A	T	17: 37,952,280	V248D	probably damaging	Het
Oxld1	T	C	11: 120,457,137	D78G	probably benign	Het
Pde1b	T	C	15: 103,524,829	I255T	probably benign	Het
Pkp4	T	A	2: 59,308,137	F244I	probably benign	Het
Polg2	C	A	11: 106,773,714	V305L	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Sash1	T	C	10: 8,756,745	D242G	possibly damaging	Het
Six4	T	C	12: 73,112,530	T219A	possibly damaging	Het
Slc28a3	A	C	13: 58,563,021	Y562*	probably null	Het
Soat1	A	T	1: 156,439,317	W310R	probably damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Spef2	T	C	15: 9,740,585	N30D	probably benign	Het
Srebf2	T	A	15: 82,172,874	I270N	probably damaging	Het
St8sia3	T	C	18: 64,271,518	W289R	probably damaging	Het
Stx5a	T	A	19: 8,743,504		probably benign	Het
Tacc1	T	C	8: 25,164,464	D689G	probably damaging	Het
Tacc3	A	G	5: 33,661,284	D21G	probably benign	Het
Tapt1	G	A	5: 44,188,688	R307*	probably null	Het
Tbc1d9b	T	A	11: 50,131,485	V16E	probably damaging	Het
Tchhl1	G	A	3: 93,470,664	R225K	probably benign	Het
Thumpd3	G	A	6: 113,055,769	G156D	probably benign	Het
Tmem178	C	T	17: 80,944,902	P72S	probably benign	Het
Tmem52	C	T	4: 155,469,469	P46S	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tulp3	A	T	6: 128,326,829	V269D	probably benign	Het
Upf1	G	A	8: 70,333,423	S962L	probably benign	Het
Vcpip1	C	T	1: 9,746,520	R546Q	probably damaging	Het
Vmn2r49	A	C	7: 9,988,893	S151R	probably benign	Het
Wac	T	C	18: 7,871,746		probably null	Het
Wrn	C	T	8: 33,335,996		probably null	Het
Zfp286	C	A	11: 62,780,801	D149Y	probably benign	Het
Zfp748	A	G	13: 67,541,972	C390R	probably damaging	Het
Zfp873	A	G	10: 82,060,376	T314A	possibly damaging	Het
Zfyve1	C	T	12: 83,551,487	D656N	probably benign	Het
Zmym1	T	A	4: 127,058,935	K18*	probably null	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- ATACTGTCATAAAAGCAGACAGGTG -3'
(R):5'- AGGCTAGGATTGGTTACTTATCATC -3'

Sequencing Primer
(F):5'- GCTCTTCCAAAGGTCAGGAGTTC -3'
(R):5'- AGGATTGGTTACTTATCATCCTGACC -3'

Posted On

2019-10-07