Incidental Mutation 'R7464:Asxl1'
ID578611
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Nameadditional sex combs like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location153345829-153404007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 153397785 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 499 (A499S)
Ref Sequence ENSEMBL: ENSMUSP00000105413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
Predicted Effect probably benign
Transcript: ENSMUST00000109790
AA Change: A499S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: A499S

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227428
AA Change: A498S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153392940 splice site probably benign
IGL01432:Asxl1 APN 2 153400205 missense probably benign 0.38
IGL01543:Asxl1 APN 2 153401484 missense probably benign 0.11
IGL02355:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02362:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02645:Asxl1 APN 2 153392857 missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153400195 nonsense probably null
IGL03365:Asxl1 APN 2 153401754 missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153400413 missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153396780 missense probably damaging 1.00
astrophel UTSW 2 153400106 missense possibly damaging 0.75
hairbrush UTSW 2 153400724 missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0600:Asxl1 UTSW 2 153399904 missense probably benign 0.00
R0659:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0661:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153397522 missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153400455 missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153393454 missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153401606 missense probably benign 0.31
R1914:Asxl1 UTSW 2 153401906 missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153352267 missense possibly damaging 0.95
R2373:Asxl1 UTSW 2 153401900 missense probably benign 0.13
R2910:Asxl1 UTSW 2 153401039 missense probably benign 0.00
R3620:Asxl1 UTSW 2 153357155 missense probably damaging 1.00
R3701:Asxl1 UTSW 2 153399344 missense probably benign 0.04
R4200:Asxl1 UTSW 2 153400106 missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153399831 missense probably benign 0.02
R5100:Asxl1 UTSW 2 153397931 missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153400955 missense probably benign 0.00
R5166:Asxl1 UTSW 2 153401121 missense probably damaging 1.00
R5421:Asxl1 UTSW 2 153399584 missense probably benign 0.04
R5701:Asxl1 UTSW 2 153399489 missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153399390 missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153402011 missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153391824 critical splice donor site probably null
R7023:Asxl1 UTSW 2 153400549 missense probably benign 0.00
R7028:Asxl1 UTSW 2 153400107 missense probably benign 0.00
R7176:Asxl1 UTSW 2 153401988 missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153397435 missense probably benign 0.01
R7378:Asxl1 UTSW 2 153401993 missense probably damaging 1.00
R7678:Asxl1 UTSW 2 153400652 missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153391614 missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153400023 missense probably benign 0.00
R7838:Asxl1 UTSW 2 153396813 missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153399934 missense possibly damaging 0.65
R8281:Asxl1 UTSW 2 153399401 missense probably damaging 1.00
R8354:Asxl1 UTSW 2 153393425 missense probably benign 0.40
R8383:Asxl1 UTSW 2 153393719 missense probably damaging 1.00
R8995:Asxl1 UTSW 2 153393966 missense probably damaging 1.00
X0024:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAACCAGATCCAGAAGG -3'
(R):5'- TCGGTGTGAACACTTTCAATTG -3'

Sequencing Primer
(F):5'- TTGCTAAAGATGCAAGTGCTG -3'
(R):5'- GTGTTACGAAAGGACTGACGATCTTC -3'
Posted On2019-10-07