Mutagenetix > Incidental Mutation

Incidental Mutation 'R7464:Asxl1'

578611

Institutional Source

Beutler Lab

Gene Symbol

Asxl1

Ensembl Gene

ENSMUSG00000042548

Gene Name

additional sex combs like 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7464 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153345829-153404007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 153397785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 499 (A499S)

Ref Sequence

ENSEMBL: ENSMUSP00000105413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]

AlphaFold

P59598

Predicted Effect

probably benign
Transcript: ENSMUST00000109790
AA Change: A499S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: A499S

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.6e-20	PFAM
low complexity region	199	209	N/A	INTRINSIC
Pfam:ASXH	236	361	5.9e-40	PFAM
low complexity region	411	422	N/A	INTRINSIC
low complexity region	639	667	N/A	INTRINSIC
low complexity region	705	716	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
Pfam:PHD_3	1446	1512	6.3e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000227428
AA Change: A498S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	C	T	6: 23,077,153	G736R	possibly damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Ankar	A	T	1: 72,698,894	V43E	possibly damaging	Het
Apof	A	G	10: 128,269,636	I220V	probably benign	Het
Baz2a	T	A	10: 128,122,073	D1069E	possibly damaging	Het
Baz2b	T	C	2: 59,977,448	T156A	possibly damaging	Het
Bbc3	A	T	7: 16,317,157	R169W	unknown	Het
C5ar1	T	A	7: 16,248,766	I110L	probably benign	Het
C87414	C	T	5: 93,636,240	C455Y	probably damaging	Het
Cd19	C	A	7: 126,411,803	R323L	probably damaging	Het
Cdc14b	A	T	13: 64,196,675	C113*	probably null	Het
Cngb1	C	A	8: 95,254,183	W914L	possibly damaging	Het
Colgalt2	A	G	1: 152,504,144	K445E	probably damaging	Het
Crebrf	A	G	17: 26,763,487	M608V	unknown	Het
Csf1	T	A	3: 107,748,875	H280L	probably benign	Het
Cyp2j11	C	A	4: 96,345,120	R113L	probably damaging	Het
D5Ertd579e	G	A	5: 36,613,785	H1089Y	probably damaging	Het
Ddx60	C	T	8: 61,940,674	T48M	possibly damaging	Het
Dock10	T	C	1: 80,540,315	D1315G	probably damaging	Het
Dock2	T	G	11: 34,695,278	N526H	probably damaging	Het
Dram2	T	C	3: 106,573,683	*268Q	probably null	Het
Emc8	A	G	8: 120,667,918	Y21H	possibly damaging	Het
Fam162a	A	G	16: 36,071,493	L4P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbxw10	T	A	11: 62,853,298	I307N	probably benign	Het
Fbxw16	A	G	9: 109,439,551	V257A	possibly damaging	Het
Fer1l6	T	A	15: 58,573,247		probably null	Het
Galnt7	A	G	8: 57,584,020	Y112H	possibly damaging	Het
Gigyf2	T	C	1: 87,428,604	I803T	unknown	Het
Gm10696	A	T	3: 94,176,104	N133K	probably benign	Het
Gm15292	T	A	8: 21,249,894	S45T	probably damaging	Het
Gm28729	A	G	9: 96,521,235	I44T	possibly damaging	Het
Gm5447	A	G	13: 30,974,394	I34V	not run	Het
H2-M9	A	T	17: 36,642,411		probably null	Het
Helz	G	A	11: 107,636,278	C864Y	probably damaging	Het
Il25	A	G	14: 54,933,222	Y84C	probably null	Het
Itga10	T	A	3: 96,648,155	C142S	probably damaging	Het
Kcna10	A	T	3: 107,194,079	M9L	probably damaging	Het
Klhl6	G	T	16: 19,957,113	Q232K	possibly damaging	Het
Mb21d2	T	G	16: 28,929,546	I40L	possibly damaging	Het
Mdm1	T	C	10: 118,152,266	S334P	probably benign	Het
Mllt10	T	A	2: 18,170,279	D549E	probably benign	Het
Mlxipl	T	C	5: 135,133,628	V648A	probably benign	Het
Nars2	A	G	7: 97,039,930	K353R	probably benign	Het
Nav1	T	A	1: 135,584,909	M138L	probably benign	Het
Neb	T	C	2: 52,193,890	T5635A	probably benign	Het
Nktr	A	C	9: 121,750,327	I1154L	unknown	Het
Olfr1284	T	A	2: 111,379,198	L66Q	probably damaging	Het
Olfr47	T	G	6: 43,236,294	S229A	probably damaging	Het
Olfr761	A	T	17: 37,952,280	V248D	probably damaging	Het
Oxld1	T	C	11: 120,457,137	D78G	probably benign	Het
Pde1b	T	C	15: 103,524,829	I255T	probably benign	Het
Pkp4	T	A	2: 59,308,137	F244I	probably benign	Het
Polg2	C	A	11: 106,773,714	V305L	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Sash1	T	C	10: 8,756,745	D242G	possibly damaging	Het
Six4	T	C	12: 73,112,530	T219A	possibly damaging	Het
Slc28a3	A	C	13: 58,563,021	Y562*	probably null	Het
Soat1	A	T	1: 156,439,317	W310R	probably damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Spef2	T	C	15: 9,740,585	N30D	probably benign	Het
Srebf2	T	A	15: 82,172,874	I270N	probably damaging	Het
St8sia3	T	C	18: 64,271,518	W289R	probably damaging	Het
Stx5a	T	A	19: 8,743,504		probably benign	Het
Tacc1	T	C	8: 25,164,464	D689G	probably damaging	Het
Tacc3	A	G	5: 33,661,284	D21G	probably benign	Het
Tapt1	G	A	5: 44,188,688	R307*	probably null	Het
Tbc1d9b	T	A	11: 50,131,485	V16E	probably damaging	Het
Tchhl1	G	A	3: 93,470,664	R225K	probably benign	Het
Thumpd3	G	A	6: 113,055,769	G156D	probably benign	Het
Tmem178	C	T	17: 80,944,902	P72S	probably benign	Het
Tmem52	C	T	4: 155,469,469	P46S	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tulp3	A	T	6: 128,326,829	V269D	probably benign	Het
Ubr1	A	G	2: 120,889,774		probably null	Het
Upf1	G	A	8: 70,333,423	S962L	probably benign	Het
Vcpip1	C	T	1: 9,746,520	R546Q	probably damaging	Het
Vmn2r49	A	C	7: 9,988,893	S151R	probably benign	Het
Wac	T	C	18: 7,871,746		probably null	Het
Wrn	C	T	8: 33,335,996		probably null	Het
Zfp286	C	A	11: 62,780,801	D149Y	probably benign	Het
Zfp748	A	G	13: 67,541,972	C390R	probably damaging	Het
Zfp873	A	G	10: 82,060,376	T314A	possibly damaging	Het
Zfyve1	C	T	12: 83,551,487	D656N	probably benign	Het
Zmym1	T	A	4: 127,058,935	K18*	probably null	Het

Other mutations in Asxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01409:Asxl1	APN	2	153392940	splice site	probably benign
IGL01432:Asxl1	APN	2	153400205	missense	probably benign	0.38
IGL01543:Asxl1	APN	2	153401484	missense	probably benign	0.11
IGL02355:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02362:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02645:Asxl1	APN	2	153392857	missense	possibly damaging	0.94
IGL02696:Asxl1	APN	2	153400195	nonsense	probably null
IGL03365:Asxl1	APN	2	153401754	missense	probably damaging	1.00
IGL03372:Asxl1	APN	2	153400413	missense	probably damaging	0.99
IGL03377:Asxl1	APN	2	153396780	missense	probably damaging	1.00
astrophel	UTSW	2	153400106	missense	possibly damaging	0.75
hairbrush	UTSW	2	153400724	missense	possibly damaging	0.55
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0600:Asxl1	UTSW	2	153399904	missense	probably benign	0.00
R0659:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0661:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0684:Asxl1	UTSW	2	153397522	missense	probably damaging	1.00
R1606:Asxl1	UTSW	2	153400455	missense	probably damaging	0.99
R1747:Asxl1	UTSW	2	153393454	missense	possibly damaging	0.86
R1796:Asxl1	UTSW	2	153401606	missense	probably benign	0.31
R1914:Asxl1	UTSW	2	153401906	missense	probably damaging	1.00
R2099:Asxl1	UTSW	2	153352267	missense	possibly damaging	0.95
R2373:Asxl1	UTSW	2	153401900	missense	probably benign	0.13
R2910:Asxl1	UTSW	2	153401039	missense	probably benign	0.00
R3620:Asxl1	UTSW	2	153357155	missense	probably damaging	1.00
R3701:Asxl1	UTSW	2	153399344	missense	probably benign	0.04
R4200:Asxl1	UTSW	2	153400106	missense	possibly damaging	0.75
R4773:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00
R4902:Asxl1	UTSW	2	153399831	missense	probably benign	0.02
R5100:Asxl1	UTSW	2	153397931	missense	probably damaging	1.00
R5102:Asxl1	UTSW	2	153400955	missense	probably benign	0.00
R5166:Asxl1	UTSW	2	153401121	missense	probably damaging	1.00
R5421:Asxl1	UTSW	2	153399584	missense	probably benign	0.04
R5701:Asxl1	UTSW	2	153399489	missense	probably damaging	1.00
R5861:Asxl1	UTSW	2	153399390	missense	probably damaging	0.99
R5973:Asxl1	UTSW	2	153402011	missense	probably damaging	0.97
R6384:Asxl1	UTSW	2	153391824	critical splice donor site	probably null
R7023:Asxl1	UTSW	2	153400549	missense	probably benign	0.00
R7028:Asxl1	UTSW	2	153400107	missense	probably benign	0.00
R7176:Asxl1	UTSW	2	153401988	missense	probably damaging	1.00
R7297:Asxl1	UTSW	2	153397435	missense	probably benign	0.01
R7378:Asxl1	UTSW	2	153401993	missense	probably damaging	1.00
R7678:Asxl1	UTSW	2	153400652	missense	probably damaging	1.00
R7686:Asxl1	UTSW	2	153391614	missense	probably damaging	1.00
R7789:Asxl1	UTSW	2	153400023	missense	probably benign	0.00
R7838:Asxl1	UTSW	2	153396813	missense	probably damaging	1.00
R7898:Asxl1	UTSW	2	153399934	missense	possibly damaging	0.65
R8281:Asxl1	UTSW	2	153399401	missense	probably damaging	1.00
R8354:Asxl1	UTSW	2	153393425	missense	probably benign	0.40
R8383:Asxl1	UTSW	2	153393719	missense	probably damaging	1.00
R8995:Asxl1	UTSW	2	153393966	missense	probably damaging	1.00
R9183:Asxl1	UTSW	2	153397920	missense	probably damaging	0.99
X0024:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCGAACCAGATCCAGAAGG -3'
(R):5'- TCGGTGTGAACACTTTCAATTG -3'

Sequencing Primer
(F):5'- TTGCTAAAGATGCAAGTGCTG -3'
(R):5'- GTGTTACGAAAGGACTGACGATCTTC -3'

Posted On

2019-10-07