Incidental Mutation 'R7464:Itga10'
ID 578614
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Name integrin, alpha 10
Synonyms
MMRRC Submission 045538-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R7464 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 96552900-96571835 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96555471 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 142 (C142S)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000048766] [ENSMUST00000118557] [ENSMUST00000119365] [ENSMUST00000137564] [ENSMUST00000156015] [ENSMUST00000165842]
AlphaFold E9Q6R1
Predicted Effect probably damaging
Transcript: ENSMUST00000029744
AA Change: C142S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: C142S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048766
SMART Domains Protein: ENSMUSP00000037962
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118557
SMART Domains Protein: ENSMUSP00000113365
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 8.3e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119365
AA Change: C142S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: C142S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137564
AA Change: C327S
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447
AA Change: C327S

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156015
Predicted Effect probably benign
Transcript: ENSMUST00000165842
SMART Domains Protein: ENSMUSP00000126631
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 3 237 8.9e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,152 (GRCm39) G736R possibly damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Ankar A T 1: 72,738,053 (GRCm39) V43E possibly damaging Het
Apof A G 10: 128,105,505 (GRCm39) I220V probably benign Het
Asxl1 G T 2: 153,239,705 (GRCm39) A499S probably benign Het
Baz2a T A 10: 127,957,942 (GRCm39) D1069E possibly damaging Het
Baz2b T C 2: 59,807,792 (GRCm39) T156A possibly damaging Het
Bbc3 A T 7: 16,051,082 (GRCm39) R169W unknown Het
C5ar1 T A 7: 15,982,691 (GRCm39) I110L probably benign Het
Cd19 C A 7: 126,010,975 (GRCm39) R323L probably damaging Het
Cdc14b A T 13: 64,344,489 (GRCm39) C113* probably null Het
Cngb1 C A 8: 95,980,811 (GRCm39) W914L possibly damaging Het
Colgalt2 A G 1: 152,379,895 (GRCm39) K445E probably damaging Het
Crebrf A G 17: 26,982,461 (GRCm39) M608V unknown Het
Csf1 T A 3: 107,656,191 (GRCm39) H280L probably benign Het
Cyp2j11 C A 4: 96,233,357 (GRCm39) R113L probably damaging Het
D5Ertd579e G A 5: 36,771,129 (GRCm39) H1089Y probably damaging Het
Ddx60 C T 8: 62,393,708 (GRCm39) T48M possibly damaging Het
Defa40 T A 8: 21,739,910 (GRCm39) S45T probably damaging Het
Dock10 T C 1: 80,518,032 (GRCm39) D1315G probably damaging Het
Dock2 T G 11: 34,586,105 (GRCm39) N526H probably damaging Het
Dram2 T C 3: 106,480,999 (GRCm39) *268Q probably null Het
Emc8 A G 8: 121,394,657 (GRCm39) Y21H possibly damaging Het
Fam162a A G 16: 35,891,863 (GRCm39) L4P probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fbxw10 T A 11: 62,744,124 (GRCm39) I307N probably benign Het
Fbxw16 A G 9: 109,268,619 (GRCm39) V257A possibly damaging Het
Fer1l6 T A 15: 58,445,096 (GRCm39) probably null Het
Galnt7 A G 8: 58,037,054 (GRCm39) Y112H possibly damaging Het
Gigyf2 T C 1: 87,356,326 (GRCm39) I803T unknown Het
Gm28729 A G 9: 96,403,288 (GRCm39) I44T possibly damaging Het
Gm5447 A G 13: 31,158,377 (GRCm39) I34V not run Het
H2-M9 A T 17: 36,953,303 (GRCm39) probably null Het
Helz G A 11: 107,527,104 (GRCm39) C864Y probably damaging Het
Il25 A G 14: 55,170,679 (GRCm39) Y84C probably null Het
Kcna10 A T 3: 107,101,395 (GRCm39) M9L probably damaging Het
Klhl6 G T 16: 19,775,863 (GRCm39) Q232K possibly damaging Het
Mb21d2 T G 16: 28,748,298 (GRCm39) I40L possibly damaging Het
Mdm1 T C 10: 117,988,171 (GRCm39) S334P probably benign Het
Mllt10 T A 2: 18,175,090 (GRCm39) D549E probably benign Het
Mlxipl T C 5: 135,162,482 (GRCm39) V648A probably benign Het
Nars2 A G 7: 96,689,137 (GRCm39) K353R probably benign Het
Nav1 T A 1: 135,512,647 (GRCm39) M138L probably benign Het
Neb T C 2: 52,083,902 (GRCm39) T5635A probably benign Het
Nktr A C 9: 121,579,393 (GRCm39) I1154L unknown Het
Or14j8 A T 17: 38,263,171 (GRCm39) V248D probably damaging Het
Or2a57 T G 6: 43,213,228 (GRCm39) S229A probably damaging Het
Or4g17 T A 2: 111,209,543 (GRCm39) L66Q probably damaging Het
Oxld1 T C 11: 120,347,963 (GRCm39) D78G probably benign Het
Pde1b T C 15: 103,433,256 (GRCm39) I255T probably benign Het
Pkp4 T A 2: 59,138,481 (GRCm39) F244I probably benign Het
Polg2 C A 11: 106,664,540 (GRCm39) V305L probably benign Het
Pramel34 C T 5: 93,784,099 (GRCm39) C455Y probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Sash1 T C 10: 8,632,509 (GRCm39) D242G possibly damaging Het
Six4 T C 12: 73,159,304 (GRCm39) T219A possibly damaging Het
Slc28a3 A C 13: 58,710,835 (GRCm39) Y562* probably null Het
Soat1 A T 1: 156,266,887 (GRCm39) W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Spef2 T C 15: 9,740,671 (GRCm39) N30D probably benign Het
Spopfm2 A T 3: 94,083,411 (GRCm39) N133K probably benign Het
Srebf2 T A 15: 82,057,075 (GRCm39) I270N probably damaging Het
St8sia3 T C 18: 64,404,589 (GRCm39) W289R probably damaging Het
Stx5a T A 19: 8,720,868 (GRCm39) probably benign Het
Tacc1 T C 8: 25,654,480 (GRCm39) D689G probably damaging Het
Tacc3 A G 5: 33,818,628 (GRCm39) D21G probably benign Het
Tapt1 G A 5: 44,346,030 (GRCm39) R307* probably null Het
Tbc1d9b T A 11: 50,022,312 (GRCm39) V16E probably damaging Het
Tchhl1 G A 3: 93,377,971 (GRCm39) R225K probably benign Het
Thumpd3 G A 6: 113,032,730 (GRCm39) G156D probably benign Het
Tmem178 C T 17: 81,252,331 (GRCm39) P72S probably benign Het
Tmem52 C T 4: 155,553,926 (GRCm39) P46S probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tulp3 A T 6: 128,303,792 (GRCm39) V269D probably benign Het
Ubr1 A G 2: 120,720,255 (GRCm39) probably null Het
Upf1 G A 8: 70,786,073 (GRCm39) S962L probably benign Het
Vcpip1 C T 1: 9,816,745 (GRCm39) R546Q probably damaging Het
Vmn2r49 A C 7: 9,722,820 (GRCm39) S151R probably benign Het
Wac T C 18: 7,871,746 (GRCm39) probably null Het
Wrn C T 8: 33,826,024 (GRCm39) probably null Het
Zfp286 C A 11: 62,671,627 (GRCm39) D149Y probably benign Het
Zfp748 A G 13: 67,690,091 (GRCm39) C390R probably damaging Het
Zfp873 A G 10: 81,896,210 (GRCm39) T314A possibly damaging Het
Zfyve1 C T 12: 83,598,261 (GRCm39) D656N probably benign Het
Zmym1 T A 4: 126,952,728 (GRCm39) K18* probably null Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96,554,957 (GRCm39) missense probably damaging 0.96
IGL01694:Itga10 APN 3 96,559,833 (GRCm39) missense probably damaging 0.99
IGL01754:Itga10 APN 3 96,564,091 (GRCm39) unclassified probably benign
IGL02527:Itga10 APN 3 96,562,940 (GRCm39) unclassified probably benign
IGL02956:Itga10 APN 3 96,562,429 (GRCm39) missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96,562,104 (GRCm39) missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96,557,836 (GRCm39) missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96,569,948 (GRCm39) missense probably damaging 0.99
R0153:Itga10 UTSW 3 96,561,016 (GRCm39) missense probably benign 0.00
R0308:Itga10 UTSW 3 96,558,780 (GRCm39) missense probably damaging 1.00
R0331:Itga10 UTSW 3 96,559,799 (GRCm39) missense probably damaging 1.00
R0413:Itga10 UTSW 3 96,556,375 (GRCm39) missense probably damaging 1.00
R0437:Itga10 UTSW 3 96,556,453 (GRCm39) missense probably damaging 1.00
R0511:Itga10 UTSW 3 96,565,490 (GRCm39) missense probably damaging 1.00
R0630:Itga10 UTSW 3 96,563,615 (GRCm39) unclassified probably benign
R0844:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R0849:Itga10 UTSW 3 96,559,846 (GRCm39) missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96,560,976 (GRCm39) missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1027:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1341:Itga10 UTSW 3 96,559,811 (GRCm39) missense probably damaging 1.00
R1350:Itga10 UTSW 3 96,564,793 (GRCm39) missense probably benign 0.01
R1370:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1467:Itga10 UTSW 3 96,559,545 (GRCm39) nonsense probably null
R1467:Itga10 UTSW 3 96,559,545 (GRCm39) nonsense probably null
R1589:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1590:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1601:Itga10 UTSW 3 96,560,974 (GRCm39) missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96,570,293 (GRCm39) missense probably damaging 0.96
R1665:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1667:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1686:Itga10 UTSW 3 96,559,141 (GRCm39) missense probably damaging 0.97
R1972:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R1976:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2020:Itga10 UTSW 3 96,559,806 (GRCm39) missense probably damaging 1.00
R2040:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2044:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2044:Itga10 UTSW 3 96,565,006 (GRCm39) missense probably benign
R2045:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R2060:Itga10 UTSW 3 96,562,314 (GRCm39) nonsense probably null
R2146:Itga10 UTSW 3 96,561,039 (GRCm39) missense probably damaging 1.00
R2146:Itga10 UTSW 3 96,558,808 (GRCm39) missense possibly damaging 0.59
R2170:Itga10 UTSW 3 96,557,773 (GRCm39) missense probably damaging 1.00
R2893:Itga10 UTSW 3 96,562,416 (GRCm39) missense probably benign 0.11
R2926:Itga10 UTSW 3 96,560,165 (GRCm39) missense probably damaging 1.00
R3622:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R3623:Itga10 UTSW 3 96,559,054 (GRCm39) splice site probably benign
R4416:Itga10 UTSW 3 96,565,562 (GRCm39) missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96,555,020 (GRCm39) missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96,559,527 (GRCm39) nonsense probably null
R5095:Itga10 UTSW 3 96,555,480 (GRCm39) missense probably benign 0.21
R5495:Itga10 UTSW 3 96,554,687 (GRCm39) missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96,559,901 (GRCm39) missense probably benign 0.38
R6114:Itga10 UTSW 3 96,556,351 (GRCm39) missense probably damaging 1.00
R6172:Itga10 UTSW 3 96,554,753 (GRCm39) missense probably benign 0.18
R6275:Itga10 UTSW 3 96,565,501 (GRCm39) missense probably benign 0.36
R6298:Itga10 UTSW 3 96,564,078 (GRCm39) missense probably benign 0.00
R6433:Itga10 UTSW 3 96,565,357 (GRCm39) critical splice donor site probably null
R6841:Itga10 UTSW 3 96,564,030 (GRCm39) missense probably damaging 1.00
R6909:Itga10 UTSW 3 96,569,915 (GRCm39) missense probably benign 0.00
R6927:Itga10 UTSW 3 96,564,030 (GRCm39) missense probably damaging 1.00
R7124:Itga10 UTSW 3 96,559,081 (GRCm39) missense probably damaging 0.96
R7310:Itga10 UTSW 3 96,555,475 (GRCm39) missense probably damaging 1.00
R7387:Itga10 UTSW 3 96,560,094 (GRCm39) missense probably benign 0.11
R7624:Itga10 UTSW 3 96,560,269 (GRCm39) missense probably benign
R7638:Itga10 UTSW 3 96,564,707 (GRCm39) splice site probably null
R7639:Itga10 UTSW 3 96,556,898 (GRCm39) missense probably benign 0.36
R7893:Itga10 UTSW 3 96,556,928 (GRCm39) missense probably damaging 1.00
R8297:Itga10 UTSW 3 96,562,116 (GRCm39) missense probably damaging 1.00
R8753:Itga10 UTSW 3 96,558,471 (GRCm39) missense probably damaging 1.00
R9526:Itga10 UTSW 3 96,564,273 (GRCm39) missense probably damaging 1.00
X0064:Itga10 UTSW 3 96,560,252 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACCGTGGTAAGGGAAATTAGTC -3'
(R):5'- AGCCTCTTCTGCAAGCACAC -3'

Sequencing Primer
(F):5'- ATTCAAAACCCTAGAGAGCAAGG -3'
(R):5'- CACTTGGGAATGATGAGGATAGCC -3'
Posted On 2019-10-07