Mutagenetix > Incidental Mutation

Incidental Mutation 'R7464:Mlxipl'

578625

Institutional Source

Beutler Lab

Gene Symbol

Mlxipl

Ensembl Gene

ENSMUSG00000005373

Gene Name

MLX interacting protein-like

Synonyms

WS-bHLH, Wbscr14, bHLHd14, ChREBP

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.499) question?

Stock #

R7464 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135089890-135138382 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135133628 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 648 (V648A)

Ref Sequence

ENSEMBL: ENSMUSP00000005507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]

AlphaFold

Q99MZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000005507
AA Change: V648A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: V648A

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	1e-8	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
HLH	667	721	1.14e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123370

SMART Domains

Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
HLH	19	73	1.14e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128691
AA Change: V648A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373
AA Change: V648A

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1hloa_	658	709	6e-7	SMART
Blast:HLH	667	699	1e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000129008

SMART Domains

Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142385

SMART Domains

Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153519
AA Change: V648A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373
AA Change: V648A

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1am9a_	658	696	1e-5	SMART
Blast:HLH	667	698	2e-12	BLAST
low complexity region	728	744	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373
AA Change: V6A

Domain	Start	End	E-Value	Type
HLH	26	120	7.9e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	C	T	6: 23,077,153	G736R	possibly damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Ankar	A	T	1: 72,698,894	V43E	possibly damaging	Het
Apof	A	G	10: 128,269,636	I220V	probably benign	Het
Asxl1	G	T	2: 153,397,785	A499S	probably benign	Het
Baz2a	T	A	10: 128,122,073	D1069E	possibly damaging	Het
Baz2b	T	C	2: 59,977,448	T156A	possibly damaging	Het
Bbc3	A	T	7: 16,317,157	R169W	unknown	Het
C5ar1	T	A	7: 16,248,766	I110L	probably benign	Het
C87414	C	T	5: 93,636,240	C455Y	probably damaging	Het
Cd19	C	A	7: 126,411,803	R323L	probably damaging	Het
Cdc14b	A	T	13: 64,196,675	C113*	probably null	Het
Cngb1	C	A	8: 95,254,183	W914L	possibly damaging	Het
Colgalt2	A	G	1: 152,504,144	K445E	probably damaging	Het
Crebrf	A	G	17: 26,763,487	M608V	unknown	Het
Csf1	T	A	3: 107,748,875	H280L	probably benign	Het
Cyp2j11	C	A	4: 96,345,120	R113L	probably damaging	Het
D5Ertd579e	G	A	5: 36,613,785	H1089Y	probably damaging	Het
Ddx60	C	T	8: 61,940,674	T48M	possibly damaging	Het
Dock10	T	C	1: 80,540,315	D1315G	probably damaging	Het
Dock2	T	G	11: 34,695,278	N526H	probably damaging	Het
Dram2	T	C	3: 106,573,683	*268Q	probably null	Het
Emc8	A	G	8: 120,667,918	Y21H	possibly damaging	Het
Fam162a	A	G	16: 36,071,493	L4P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbxw10	T	A	11: 62,853,298	I307N	probably benign	Het
Fbxw16	A	G	9: 109,439,551	V257A	possibly damaging	Het
Fer1l6	T	A	15: 58,573,247		probably null	Het
Galnt7	A	G	8: 57,584,020	Y112H	possibly damaging	Het
Gigyf2	T	C	1: 87,428,604	I803T	unknown	Het
Gm10696	A	T	3: 94,176,104	N133K	probably benign	Het
Gm15292	T	A	8: 21,249,894	S45T	probably damaging	Het
Gm28729	A	G	9: 96,521,235	I44T	possibly damaging	Het
Gm5447	A	G	13: 30,974,394	I34V	not run	Het
H2-M9	A	T	17: 36,642,411		probably null	Het
Helz	G	A	11: 107,636,278	C864Y	probably damaging	Het
Il25	A	G	14: 54,933,222	Y84C	probably null	Het
Itga10	T	A	3: 96,648,155	C142S	probably damaging	Het
Kcna10	A	T	3: 107,194,079	M9L	probably damaging	Het
Klhl6	G	T	16: 19,957,113	Q232K	possibly damaging	Het
Mb21d2	T	G	16: 28,929,546	I40L	possibly damaging	Het
Mdm1	T	C	10: 118,152,266	S334P	probably benign	Het
Mllt10	T	A	2: 18,170,279	D549E	probably benign	Het
Nars2	A	G	7: 97,039,930	K353R	probably benign	Het
Nav1	T	A	1: 135,584,909	M138L	probably benign	Het
Neb	T	C	2: 52,193,890	T5635A	probably benign	Het
Nktr	A	C	9: 121,750,327	I1154L	unknown	Het
Olfr1284	T	A	2: 111,379,198	L66Q	probably damaging	Het
Olfr47	T	G	6: 43,236,294	S229A	probably damaging	Het
Olfr761	A	T	17: 37,952,280	V248D	probably damaging	Het
Oxld1	T	C	11: 120,457,137	D78G	probably benign	Het
Pde1b	T	C	15: 103,524,829	I255T	probably benign	Het
Pkp4	T	A	2: 59,308,137	F244I	probably benign	Het
Polg2	C	A	11: 106,773,714	V305L	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Sash1	T	C	10: 8,756,745	D242G	possibly damaging	Het
Six4	T	C	12: 73,112,530	T219A	possibly damaging	Het
Slc28a3	A	C	13: 58,563,021	Y562*	probably null	Het
Soat1	A	T	1: 156,439,317	W310R	probably damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Spef2	T	C	15: 9,740,585	N30D	probably benign	Het
Srebf2	T	A	15: 82,172,874	I270N	probably damaging	Het
St8sia3	T	C	18: 64,271,518	W289R	probably damaging	Het
Stx5a	T	A	19: 8,743,504		probably benign	Het
Tacc1	T	C	8: 25,164,464	D689G	probably damaging	Het
Tacc3	A	G	5: 33,661,284	D21G	probably benign	Het
Tapt1	G	A	5: 44,188,688	R307*	probably null	Het
Tbc1d9b	T	A	11: 50,131,485	V16E	probably damaging	Het
Tchhl1	G	A	3: 93,470,664	R225K	probably benign	Het
Thumpd3	G	A	6: 113,055,769	G156D	probably benign	Het
Tmem178	C	T	17: 80,944,902	P72S	probably benign	Het
Tmem52	C	T	4: 155,469,469	P46S	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tulp3	A	T	6: 128,326,829	V269D	probably benign	Het
Ubr1	A	G	2: 120,889,774		probably null	Het
Upf1	G	A	8: 70,333,423	S962L	probably benign	Het
Vcpip1	C	T	1: 9,746,520	R546Q	probably damaging	Het
Vmn2r49	A	C	7: 9,988,893	S151R	probably benign	Het
Wac	T	C	18: 7,871,746		probably null	Het
Wrn	C	T	8: 33,335,996		probably null	Het
Zfp286	C	A	11: 62,780,801	D149Y	probably benign	Het
Zfp748	A	G	13: 67,541,972	C390R	probably damaging	Het
Zfp873	A	G	10: 82,060,376	T314A	possibly damaging	Het
Zfyve1	C	T	12: 83,551,487	D656N	probably benign	Het
Zmym1	T	A	4: 127,058,935	K18*	probably null	Het

Other mutations in Mlxipl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Mlxipl	APN	5	135132778	missense	probably damaging	0.98
IGL01872:Mlxipl	APN	5	135113691	missense	probably damaging	1.00
IGL02694:Mlxipl	APN	5	135124018	critical splice donor site	probably null
IGL03070:Mlxipl	APN	5	135132453	missense	possibly damaging	0.93
Scarlet	UTSW	5	135134030	missense	possibly damaging	0.93
H8441:Mlxipl	UTSW	5	135123961	missense	probably damaging	1.00
IGL03054:Mlxipl	UTSW	5	135133256	missense	possibly damaging	0.83
R0003:Mlxipl	UTSW	5	135133189	unclassified	probably benign
R0126:Mlxipl	UTSW	5	135132323	missense	probably damaging	0.96
R0458:Mlxipl	UTSW	5	135133370	missense	probably benign	0.33
R0513:Mlxipl	UTSW	5	135137263	missense	probably benign	0.33
R0580:Mlxipl	UTSW	5	135123975	missense	probably benign	0.01
R0744:Mlxipl	UTSW	5	135132475	missense	possibly damaging	0.86
R0827:Mlxipl	UTSW	5	135132738	missense	probably benign	0.00
R1052:Mlxipl	UTSW	5	135113710	missense	probably damaging	1.00
R1241:Mlxipl	UTSW	5	135132718	missense	probably benign	0.01
R1795:Mlxipl	UTSW	5	135107170	missense	probably damaging	1.00
R1903:Mlxipl	UTSW	5	135133568	missense	possibly damaging	0.92
R2038:Mlxipl	UTSW	5	135106999	missense	probably damaging	1.00
R2064:Mlxipl	UTSW	5	135132777	missense	possibly damaging	0.77
R2069:Mlxipl	UTSW	5	135107005	missense	probably damaging	1.00
R2081:Mlxipl	UTSW	5	135113638	missense	probably damaging	1.00
R2095:Mlxipl	UTSW	5	135122120	splice site	probably benign
R3114:Mlxipl	UTSW	5	135133662	splice site	probably benign
R4018:Mlxipl	UTSW	5	135132672	missense	probably damaging	1.00
R4090:Mlxipl	UTSW	5	135132527	missense	probably benign	0.33
R4321:Mlxipl	UTSW	5	135135450	nonsense	probably null
R4414:Mlxipl	UTSW	5	135137399	unclassified	probably benign
R5706:Mlxipl	UTSW	5	135133604	missense	probably benign	0.33
R6088:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R6508:Mlxipl	UTSW	5	135128620	missense	probably benign	0.03
R6704:Mlxipl	UTSW	5	135137240	critical splice acceptor site	probably null
R7060:Mlxipl	UTSW	5	135132315	missense	possibly damaging	0.88
R7095:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R7128:Mlxipl	UTSW	5	135133851	missense	probably damaging	0.98
R7510:Mlxipl	UTSW	5	135133118	missense	possibly damaging	0.72
R7669:Mlxipl	UTSW	5	135132370	missense	possibly damaging	0.53
R7737:Mlxipl	UTSW	5	135135381	missense	possibly damaging	0.73
R7806:Mlxipl	UTSW	5	135134543	missense	possibly damaging	0.93
R7910:Mlxipl	UTSW	5	135132409	missense	possibly damaging	0.85
R8118:Mlxipl	UTSW	5	135137248	missense	possibly damaging	0.96
R8363:Mlxipl	UTSW	5	135107076	missense	probably benign	0.18
R8701:Mlxipl	UTSW	5	135107191	missense	possibly damaging	0.53
R8725:Mlxipl	UTSW	5	135128629	missense	probably benign	0.01
R9235:Mlxipl	UTSW	5	135128687	missense	possibly damaging	0.86
R9566:Mlxipl	UTSW	5	135123762	missense	possibly damaging	0.85
R9727:Mlxipl	UTSW	5	135121534	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGCGGTAAATAGGGGCTAG -3'
(R):5'- AGCTTAATATTGAACCGCCTCTTC -3'

Sequencing Primer
(F):5'- TAAATAGGGGCTAGAGGGGTC -3'
(R):5'- TCTTCTGCTCCGCGGAGATG -3'

Posted On

2019-10-07