Incidental Mutation 'R7464:Tulp3'
ID578629
Institutional Source Beutler Lab
Gene Symbol Tulp3
Ensembl Gene ENSMUSG00000001521
Gene Nametubby-like protein 3
Synonyms2310022L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_011657; MGI: 1329045

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128321161-128355851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128326829 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 269 (V269D)
Ref Sequence ENSEMBL: ENSMUSP00000001562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001562]
Predicted Effect probably benign
Transcript: ENSMUST00000001562
AA Change: V269D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001562
Gene: ENSMUSG00000001521
AA Change: V269D

DomainStartEndE-ValueType
Pfam:Tub_N 30 84 1.7e-23 PFAM
Pfam:Tub_N 76 198 5.5e-16 PFAM
Pfam:Tub 213 454 1e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby gene family of bipartite transcription factors. Members of this family have been identified in plants, vertebrates, and invertebrates, and they share a conserved N-terminal transcription activation region and a conserved C-terminal DNA and phosphatidylinositol-phosphate binding region. The encoded protein binds to phosphoinositides in the plasma membrane via its C-terminal region and probably functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis, for instance, induced by G-protein-coupled-receptor signaling. It plays an important role in neuronal development and function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutant mice exhibit failed neural tube closure followed by neuroepithelial apoptosis and ultimately embryonic death around E14.5. Heterozygotes are largely phenotypically normal, however some exhibit neuroepithelial apoptosis and die as embryos. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, other(3) Gene trapped(31) Chemically induced(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Tulp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Tulp3 APN 6 128325884 missense probably damaging 0.99
IGL01327:Tulp3 APN 6 128327634 missense probably damaging 1.00
IGL01382:Tulp3 APN 6 128325070 missense probably damaging 1.00
IGL01633:Tulp3 APN 6 128325960 missense probably damaging 1.00
IGL02228:Tulp3 APN 6 128334485 missense probably damaging 1.00
IGL02372:Tulp3 APN 6 128327598 missense possibly damaging 0.92
D4043:Tulp3 UTSW 6 128324150 missense probably benign 0.06
R0243:Tulp3 UTSW 6 128325958 nonsense probably null
R1181:Tulp3 UTSW 6 128325952 missense possibly damaging 0.47
R1673:Tulp3 UTSW 6 128333943 unclassified probably null
R1749:Tulp3 UTSW 6 128337759 missense probably damaging 1.00
R1984:Tulp3 UTSW 6 128326806 missense probably benign 0.02
R1985:Tulp3 UTSW 6 128326806 missense probably benign 0.02
R2568:Tulp3 UTSW 6 128327638 missense probably benign 0.00
R4660:Tulp3 UTSW 6 128323054 utr 3 prime probably benign
R4779:Tulp3 UTSW 6 128323120 missense probably damaging 1.00
R5001:Tulp3 UTSW 6 128325068 missense probably damaging 1.00
R6192:Tulp3 UTSW 6 128355740 splice site probably null
R6242:Tulp3 UTSW 6 128323087 missense probably damaging 1.00
R7782:Tulp3 UTSW 6 128324980 missense possibly damaging 0.69
R7883:Tulp3 UTSW 6 128326844 missense probably damaging 1.00
R8027:Tulp3 UTSW 6 128334473 missense probably benign 0.00
R8235:Tulp3 UTSW 6 128327677 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGAAGCTGACCAGACTGC -3'
(R):5'- CATGTGGAGAAGTGTTTCCCTG -3'

Sequencing Primer
(F):5'- TGACCAGACTGCAGGGTG -3'
(R):5'- AGACAGGATCTCTTTACGTAGGCC -3'
Posted On2019-10-07