Incidental Mutation 'R7464:Nars2'
ID 578634
Institutional Source Beutler Lab
Gene Symbol Nars2
Ensembl Gene ENSMUSG00000018995
Gene Name asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7464 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 96951505-97064758 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97039930 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 353 (K353R)
Ref Sequence ENSEMBL: ENSMUSP00000044937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044466] [ENSMUST00000107159] [ENSMUST00000150681]
AlphaFold Q8BGV0
Predicted Effect probably benign
Transcript: ENSMUST00000044466
AA Change: K353R

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044937
Gene: ENSMUSG00000018995
AA Change: K353R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 2.4e-12 PFAM
Pfam:tRNA-synt_2 135 472 1.4e-100 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107159
AA Change: K353R

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102777
Gene: ENSMUSG00000018995
AA Change: K353R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 7.6e-14 PFAM
Pfam:tRNA-synt_2 135 390 5.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122835
Predicted Effect probably benign
Transcript: ENSMUST00000150681
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Nars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Nars2 APN 7 97031579 missense probably benign 0.00
IGL00796:Nars2 APN 7 97031580 missense probably benign 0.40
IGL00990:Nars2 APN 7 97002790 splice site probably benign
IGL02954:Nars2 APN 7 97039893 splice site probably null
IGL03256:Nars2 APN 7 97039910 missense possibly damaging 0.67
IGL03394:Nars2 APN 7 97040013 missense possibly damaging 0.94
R0600:Nars2 UTSW 7 97039923 missense probably damaging 1.00
R0943:Nars2 UTSW 7 96955931 splice site probably benign
R1389:Nars2 UTSW 7 97002829 missense probably benign
R4076:Nars2 UTSW 7 96958094 missense probably damaging 0.99
R4397:Nars2 UTSW 7 96973564 critical splice donor site probably null
R4758:Nars2 UTSW 7 96973528 missense probably damaging 1.00
R4771:Nars2 UTSW 7 97035245 missense probably damaging 1.00
R4908:Nars2 UTSW 7 97023741 missense probably benign 0.07
R5162:Nars2 UTSW 7 97059820 utr 3 prime probably benign
R6209:Nars2 UTSW 7 97057521 missense probably benign 0.00
R7979:Nars2 UTSW 7 97062661 missense probably damaging 1.00
R8284:Nars2 UTSW 7 96951638 utr 5 prime probably benign
R8885:Nars2 UTSW 7 97002888 missense probably damaging 0.98
R9614:Nars2 UTSW 7 97039918 missense probably damaging 0.99
R9658:Nars2 UTSW 7 97039971 missense probably benign 0.00
Z1176:Nars2 UTSW 7 96951897 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTGTTCTTATTAGCAAGCATTCC -3'
(R):5'- TAGAACACTGGGCTCTGTGG -3'

Sequencing Primer
(F):5'- AGCAAGCATTCCCCCTTTGG -3'
(R):5'- CTCTGTGGGAAGACCGATG -3'
Posted On 2019-10-07