Mutagenetix > Incidental Mutation

Incidental Mutation 'R7464:Sash1'

578647

Institutional Source

Beutler Lab

Gene Symbol

Sash1

Ensembl Gene

ENSMUSG00000015305

Gene Name

SAM and SH3 domain containing 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7464 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8722219-8886070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8756745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 242 (D242G)

Ref Sequence

ENSEMBL: ENSMUSP00000015449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015449] [ENSMUST00000212553] [ENSMUST00000212869]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015449
AA Change: D242G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: D242G

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
coiled coil region	185	212	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
Pfam:SLY	394	548	1.2e-46	PFAM
SH3	550	607	1.16e-3	SMART
SAM	623	690	1.83e-11	SMART
low complexity region	1008	1021	N/A	INTRINSIC
SAM	1157	1224	3.6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212553
AA Change: D10G

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212869
AA Change: D6G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	C	T	6: 23,077,153	G736R	possibly damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Ankar	A	T	1: 72,698,894	V43E	possibly damaging	Het
Apof	A	G	10: 128,269,636	I220V	probably benign	Het
Asxl1	G	T	2: 153,397,785	A499S	probably benign	Het
Baz2a	T	A	10: 128,122,073	D1069E	possibly damaging	Het
Baz2b	T	C	2: 59,977,448	T156A	possibly damaging	Het
Bbc3	A	T	7: 16,317,157	R169W	unknown	Het
C5ar1	T	A	7: 16,248,766	I110L	probably benign	Het
C87414	C	T	5: 93,636,240	C455Y	probably damaging	Het
Cd19	C	A	7: 126,411,803	R323L	probably damaging	Het
Cdc14b	A	T	13: 64,196,675	C113*	probably null	Het
Cngb1	C	A	8: 95,254,183	W914L	possibly damaging	Het
Colgalt2	A	G	1: 152,504,144	K445E	probably damaging	Het
Crebrf	A	G	17: 26,763,487	M608V	unknown	Het
Csf1	T	A	3: 107,748,875	H280L	probably benign	Het
Cyp2j11	C	A	4: 96,345,120	R113L	probably damaging	Het
D5Ertd579e	G	A	5: 36,613,785	H1089Y	probably damaging	Het
Ddx60	C	T	8: 61,940,674	T48M	possibly damaging	Het
Dock10	T	C	1: 80,540,315	D1315G	probably damaging	Het
Dock2	T	G	11: 34,695,278	N526H	probably damaging	Het
Dram2	T	C	3: 106,573,683	*268Q	probably null	Het
Emc8	A	G	8: 120,667,918	Y21H	possibly damaging	Het
Fam162a	A	G	16: 36,071,493	L4P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbxw10	T	A	11: 62,853,298	I307N	probably benign	Het
Fbxw16	A	G	9: 109,439,551	V257A	possibly damaging	Het
Fer1l6	T	A	15: 58,573,247		probably null	Het
Galnt7	A	G	8: 57,584,020	Y112H	possibly damaging	Het
Gigyf2	T	C	1: 87,428,604	I803T	unknown	Het
Gm10696	A	T	3: 94,176,104	N133K	probably benign	Het
Gm15292	T	A	8: 21,249,894	S45T	probably damaging	Het
Gm28729	A	G	9: 96,521,235	I44T	possibly damaging	Het
Gm5447	A	G	13: 30,974,394	I34V	not run	Het
H2-M9	A	T	17: 36,642,411		probably null	Het
Helz	G	A	11: 107,636,278	C864Y	probably damaging	Het
Il25	A	G	14: 54,933,222	Y84C	probably null	Het
Itga10	T	A	3: 96,648,155	C142S	probably damaging	Het
Kcna10	A	T	3: 107,194,079	M9L	probably damaging	Het
Klhl6	G	T	16: 19,957,113	Q232K	possibly damaging	Het
Mb21d2	T	G	16: 28,929,546	I40L	possibly damaging	Het
Mdm1	T	C	10: 118,152,266	S334P	probably benign	Het
Mllt10	T	A	2: 18,170,279	D549E	probably benign	Het
Mlxipl	T	C	5: 135,133,628	V648A	probably benign	Het
Nars2	A	G	7: 97,039,930	K353R	probably benign	Het
Nav1	T	A	1: 135,584,909	M138L	probably benign	Het
Neb	T	C	2: 52,193,890	T5635A	probably benign	Het
Nktr	A	C	9: 121,750,327	I1154L	unknown	Het
Olfr1284	T	A	2: 111,379,198	L66Q	probably damaging	Het
Olfr47	T	G	6: 43,236,294	S229A	probably damaging	Het
Olfr761	A	T	17: 37,952,280	V248D	probably damaging	Het
Oxld1	T	C	11: 120,457,137	D78G	probably benign	Het
Pde1b	T	C	15: 103,524,829	I255T	probably benign	Het
Pkp4	T	A	2: 59,308,137	F244I	probably benign	Het
Polg2	C	A	11: 106,773,714	V305L	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Six4	T	C	12: 73,112,530	T219A	possibly damaging	Het
Slc28a3	A	C	13: 58,563,021	Y562*	probably null	Het
Soat1	A	T	1: 156,439,317	W310R	probably damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Spef2	T	C	15: 9,740,585	N30D	probably benign	Het
Srebf2	T	A	15: 82,172,874	I270N	probably damaging	Het
St8sia3	T	C	18: 64,271,518	W289R	probably damaging	Het
Stx5a	T	A	19: 8,743,504		probably benign	Het
Tacc1	T	C	8: 25,164,464	D689G	probably damaging	Het
Tacc3	A	G	5: 33,661,284	D21G	probably benign	Het
Tapt1	G	A	5: 44,188,688	R307*	probably null	Het
Tbc1d9b	T	A	11: 50,131,485	V16E	probably damaging	Het
Tchhl1	G	A	3: 93,470,664	R225K	probably benign	Het
Thumpd3	G	A	6: 113,055,769	G156D	probably benign	Het
Tmem178	C	T	17: 80,944,902	P72S	probably benign	Het
Tmem52	C	T	4: 155,469,469	P46S	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tulp3	A	T	6: 128,326,829	V269D	probably benign	Het
Ubr1	A	G	2: 120,889,774		probably null	Het
Upf1	G	A	8: 70,333,423	S962L	probably benign	Het
Vcpip1	C	T	1: 9,746,520	R546Q	probably damaging	Het
Vmn2r49	A	C	7: 9,988,893	S151R	probably benign	Het
Wac	T	C	18: 7,871,746		probably null	Het
Wrn	C	T	8: 33,335,996		probably null	Het
Zfp286	C	A	11: 62,780,801	D149Y	probably benign	Het
Zfp748	A	G	13: 67,541,972	C390R	probably damaging	Het
Zfp873	A	G	10: 82,060,376	T314A	possibly damaging	Het
Zfyve1	C	T	12: 83,551,487	D656N	probably benign	Het
Zmym1	T	A	4: 127,058,935	K18*	probably null	Het

Other mutations in Sash1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Sash1	APN	10	8751413	missense	probably damaging	1.00
IGL01535:Sash1	APN	10	8741577	missense	probably damaging	1.00
IGL01537:Sash1	APN	10	8729658	missense	probably damaging	1.00
IGL01788:Sash1	APN	10	8733646	missense	probably benign	0.01
IGL01933:Sash1	APN	10	8751133	missense	probably damaging	0.99
IGL02126:Sash1	APN	10	8739465	missense	probably damaging	0.96
IGL02285:Sash1	APN	10	8740334	missense	probably damaging	0.99
IGL02400:Sash1	APN	10	8733647	nonsense	probably null
IGL02504:Sash1	APN	10	8729912	missense	probably benign	0.00
IGL02630:Sash1	APN	10	8744535	missense	probably benign	0.06
boyscout	UTSW	10	8742422	splice site	probably null
cubscout	UTSW	10	8729713	missense	probably benign	0.01
R0592:Sash1	UTSW	10	8729782	missense	probably benign	0.00
R0647:Sash1	UTSW	10	8729552	missense	probably damaging	0.99
R0656:Sash1	UTSW	10	8751137	critical splice donor site	probably null
R0830:Sash1	UTSW	10	8729909	missense	probably benign	0.01
R0919:Sash1	UTSW	10	8730079	missense	probably benign	0.01
R1470:Sash1	UTSW	10	8789593	missense	probably damaging	1.00
R1470:Sash1	UTSW	10	8789593	missense	probably damaging	1.00
R1606:Sash1	UTSW	10	8729957	missense	probably benign	0.00
R1707:Sash1	UTSW	10	8730377	missense	probably benign	0.00
R1922:Sash1	UTSW	10	8727908	missense	possibly damaging	0.62
R1940:Sash1	UTSW	10	8729932	missense	probably benign
R1964:Sash1	UTSW	10	8729713	missense	probably benign	0.01
R2013:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2014:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2015:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2074:Sash1	UTSW	10	8756697	missense	probably damaging	1.00
R2252:Sash1	UTSW	10	8729977	missense	probably benign	0.01
R2253:Sash1	UTSW	10	8729977	missense	probably benign	0.01
R2260:Sash1	UTSW	10	8786378	nonsense	probably null
R3085:Sash1	UTSW	10	8742422	splice site	probably null
R4024:Sash1	UTSW	10	8729917	missense	probably benign	0.00
R4039:Sash1	UTSW	10	8729627	missense	probably damaging	1.00
R4290:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4292:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4295:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4301:Sash1	UTSW	10	8751470	missense	probably benign	0.00
R4657:Sash1	UTSW	10	8725660	missense	probably damaging	1.00
R4669:Sash1	UTSW	10	8730385	missense	probably benign	0.00
R4719:Sash1	UTSW	10	8729713	missense	probably benign	0.01
R4745:Sash1	UTSW	10	8729908	missense	probably benign
R5197:Sash1	UTSW	10	8740225	missense	probably damaging	1.00
R5217:Sash1	UTSW	10	8780604	missense	possibly damaging	0.63
R5420:Sash1	UTSW	10	8746186	missense	probably damaging	1.00
R5591:Sash1	UTSW	10	8725718	missense	probably benign	0.36
R6505:Sash1	UTSW	10	8729527	missense	probably benign	0.21
R6679:Sash1	UTSW	10	8740185	missense	probably damaging	1.00
R6761:Sash1	UTSW	10	8744522	missense	probably damaging	0.99
R6885:Sash1	UTSW	10	8784221	missense	probably damaging	1.00
R6980:Sash1	UTSW	10	8729848	missense	probably benign	0.00
R7034:Sash1	UTSW	10	8730083	nonsense	probably null
R7036:Sash1	UTSW	10	8730083	nonsense	probably null
R7088:Sash1	UTSW	10	8729717	nonsense	probably null
R7289:Sash1	UTSW	10	8730196	missense	probably damaging	0.99
R7661:Sash1	UTSW	10	8729391	missense	probably benign	0.01
R7752:Sash1	UTSW	10	8780564	nonsense	probably null
R7856:Sash1	UTSW	10	8729708	missense	probably benign	0.00
R7901:Sash1	UTSW	10	8780564	nonsense	probably null
R8152:Sash1	UTSW	10	8751041	missense	possibly damaging	0.94
R8218:Sash1	UTSW	10	8751236	missense	probably damaging	0.99
R8317:Sash1	UTSW	10	8729386	missense	possibly damaging	0.76
R8358:Sash1	UTSW	10	8729981	missense	probably benign
R8503:Sash1	UTSW	10	8780513	splice site	probably benign
R8696:Sash1	UTSW	10	8733695	missense	probably damaging	1.00
R8703:Sash1	UTSW	10	8729831	missense	probably damaging	0.99
R8710:Sash1	UTSW	10	8780521	missense	possibly damaging	0.82
R8822:Sash1	UTSW	10	8885871	start gained	probably benign
R8826:Sash1	UTSW	10	8762105	start codon destroyed	probably null
R8891:Sash1	UTSW	10	8727970	missense	probably damaging	1.00
R8968:Sash1	UTSW	10	8730415	missense	probably benign	0.00
R8984:Sash1	UTSW	10	8751044	missense	possibly damaging	0.46
R9194:Sash1	UTSW	10	8740205	missense	probably damaging	0.99
R9248:Sash1	UTSW	10	8741532	missense	probably damaging	1.00
R9405:Sash1	UTSW	10	8762230	start gained	probably benign
R9408:Sash1	UTSW	10	8762230	start gained	probably benign
R9489:Sash1	UTSW	10	8729405	missense	probably benign	0.05
R9576:Sash1	UTSW	10	8744535	missense	probably benign	0.06
R9632:Sash1	UTSW	10	8740205	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTTTCCGAAGAACCAGGGAG -3'
(R):5'- CAGCTATATTAGGCCATCCCAGAG -3'

Sequencing Primer
(F):5'- AACCAGGGAGAAGTTTGCCCC -3'
(R):5'- ATTAGGCCATCCCAGAGTATGTG -3'

Posted On

2019-10-07