Incidental Mutation 'R7464:Apof'
ID578651
Institutional Source Beutler Lab
Gene Symbol Apof
Ensembl Gene ENSMUSG00000047631
Gene Nameapolipoprotein F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128268671-128270153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128269636 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 220 (I220V)
Ref Sequence ENSEMBL: ENSMUSP00000050300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050901] [ENSMUST00000085708] [ENSMUST00000105238]
Predicted Effect probably benign
Transcript: ENSMUST00000050901
AA Change: I220V

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050300
Gene: ENSMUSG00000047631
AA Change: I220V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Apolipo_F 63 262 1.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085708
SMART Domains Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 138 314 5e-52 PFAM
Pfam:STAT_bind 316 564 1.2e-96 PFAM
SH2 576 652 4.71e-6 SMART
internal_repeat_1 750 778 6.35e-10 PROSPERO
internal_repeat_1 822 850 6.35e-10 PROSPERO
Pfam:STAT2_C 853 907 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105238
SMART Domains Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 141 314 2.6e-49 PFAM
Pfam:STAT_bind 316 564 1.5e-67 PFAM
SH2 577 653 4.71e-6 SMART
internal_repeat_1 751 779 6.69e-10 PROSPERO
internal_repeat_1 823 851 6.69e-10 PROSPERO
Pfam:STAT2_C 854 908 1.7e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the minor apolipoproteins found in plasma. This protein forms complexes with lipoproteins and may be involved in transport and/or esterification of cholesterol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ABCG1-mediated cholesterol efflux. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Apof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Apof APN 10 128269477 missense probably benign 0.00
IGL02403:Apof APN 10 128269484 unclassified probably null
IGL03113:Apof APN 10 128269699 missense probably benign 0.21
R1725:Apof UTSW 10 128269811 unclassified probably benign
R5104:Apof UTSW 10 128269618 nonsense probably null
R6460:Apof UTSW 10 128269217 missense probably damaging 1.00
R7483:Apof UTSW 10 128268767 missense probably benign
R7672:Apof UTSW 10 128269016 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCAAAGAGGGCCAAACGTTC -3'
(R):5'- CCACAACACCGATATCTGTGG -3'

Sequencing Primer
(F):5'- AGGGCCAAACGTTCGATTTC -3'
(R):5'- ACACCGATATCTGTGGTGGCATC -3'
Posted On2019-10-07