Incidental Mutation 'R7464:Polg2'
ID578656
Institutional Source Beutler Lab
Gene Symbol Polg2
Ensembl Gene ENSMUSG00000020718
Gene Namepolymerase (DNA directed), gamma 2, accessory subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106768253-106779537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106773714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 305 (V305L)
Ref Sequence ENSEMBL: ENSMUSP00000021060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021060] [ENSMUST00000126201] [ENSMUST00000127061] [ENSMUST00000134029] [ENSMUST00000147326] [ENSMUST00000155107] [ENSMUST00000182023] [ENSMUST00000182479] [ENSMUST00000183111]
PDB Structure
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021060
AA Change: V305L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021060
Gene: ENSMUSG00000020718
AA Change: V305L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SCOP:d1g5ha2 41 330 4e-36 SMART
Pfam:HGTP_anticodon 354 452 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126201
SMART Domains Protein: ENSMUSP00000116583
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 134 2e-70 PDB
SCOP:d1g5ha2 41 130 8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127061
SMART Domains Protein: ENSMUSP00000117441
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 170 1e-100 PDB
SCOP:d1g5ha2 41 163 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134029
SMART Domains Protein: ENSMUSP00000122755
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147326
SMART Domains Protein: ENSMUSP00000138742
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155107
SMART Domains Protein: ENSMUSP00000118975
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182023
SMART Domains Protein: ENSMUSP00000138286
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182479
SMART Domains Protein: ENSMUSP00000138386
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
Blast:IG 1 36 3e-19 BLAST
transmembrane domain 48 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183111
SMART Domains Protein: ENSMUSP00000138513
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the processivity subunit of the mitochondrial DNA polymerase gamma. The encoded protein forms a heterotrimer containing one catalytic subunit and two processivity subunits. This protein enhances DNA binding and promotes processive DNA synthesis. Mutations in this gene result in autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and turning, fail to initiate turning, lack mt-Co1 activity, and contain abnormal mitochondria with reduced mtDNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Polg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Polg2 APN 11 106777432 splice site probably null
IGL02205:Polg2 APN 11 106779120 missense probably benign 0.09
IGL02850:Polg2 APN 11 106768467 missense probably damaging 1.00
IGL02952:Polg2 APN 11 106772713 missense possibly damaging 0.78
IGL03328:Polg2 APN 11 106768337 missense probably benign 0.40
IGL02835:Polg2 UTSW 11 106775440 missense probably benign
R0109:Polg2 UTSW 11 106777132 splice site probably benign
R0143:Polg2 UTSW 11 106777526 missense probably benign 0.01
R0709:Polg2 UTSW 11 106768413 missense probably damaging 1.00
R1385:Polg2 UTSW 11 106768323 missense probably damaging 0.97
R1938:Polg2 UTSW 11 106778961 missense probably damaging 0.98
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R3159:Polg2 UTSW 11 106768337 missense probably benign 0.40
R3776:Polg2 UTSW 11 106779284 missense probably benign 0.01
R3982:Polg2 UTSW 11 106779202 nonsense probably null
R5306:Polg2 UTSW 11 106778970 missense probably damaging 0.98
R5338:Polg2 UTSW 11 106779238 missense possibly damaging 0.95
R7055:Polg2 UTSW 11 106777214 missense probably damaging 1.00
R7146:Polg2 UTSW 11 106772746 missense probably benign 0.01
R7645:Polg2 UTSW 11 106775593 missense probably benign
Z1176:Polg2 UTSW 11 106773429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCTGAAGCAATTAAGGGAC -3'
(R):5'- CAGTGTCCTGTCATGGAGTAG -3'

Sequencing Primer
(F):5'- GGGAAGCACTGTTAATGTGTAAG -3'
(R):5'- GTGGCACAAGCTTTGAATCC -3'
Posted On2019-10-07