Incidental Mutation 'R7464:Slc28a3'
ID578663
Institutional Source Beutler Lab
Gene Symbol Slc28a3
Ensembl Gene ENSMUSG00000021553
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 3
SynonymsCnt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location58545399-58610877 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 58563021 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 562 (Y562*)
Ref Sequence ENSEMBL: ENSMUSP00000022036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022036] [ENSMUST00000140760]
Predicted Effect probably null
Transcript: ENSMUST00000022036
AA Change: Y562*
SMART Domains Protein: ENSMUSP00000022036
Gene: ENSMUSG00000021553
AA Change: Y562*

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 146 163 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Pfam:Nucleos_tra2_N 221 292 3.5e-27 PFAM
Pfam:Gate 300 401 4.9e-11 PFAM
Pfam:Nucleos_tra2_C 403 627 4.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140760
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside transporters, such as SLC28A3, regulate multiple cellular processes, including neurotransmission, vascular tone, adenosine concentration in the vicinity of cell surface receptors, and transport and metabolism of nucleoside drugs. SLC28A3 shows broad specificity for pyrimidine and purine nucleosides (Ritzel et al., 2001 [PubMed 11032837]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Stx5a T A 19: 8,743,504 probably benign Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Slc28a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc28a3 APN 13 58574300 missense probably benign 0.05
IGL00432:Slc28a3 APN 13 58569411 splice site probably null
IGL00553:Slc28a3 APN 13 58563009 splice site probably null
IGL01725:Slc28a3 APN 13 58578510 missense probably benign 0.30
IGL02068:Slc28a3 APN 13 58558597 missense probably damaging 1.00
IGL02270:Slc28a3 APN 13 58580584 missense probably benign 0.00
IGL02271:Slc28a3 APN 13 58558637 missense probably benign 0.21
IGL02373:Slc28a3 APN 13 58578404 critical splice donor site probably null
IGL02542:Slc28a3 APN 13 58573470 missense probably damaging 1.00
IGL03242:Slc28a3 APN 13 58574249 nonsense probably null
R0256:Slc28a3 UTSW 13 58573500 missense probably benign
R0323:Slc28a3 UTSW 13 58564052 nonsense probably null
R0391:Slc28a3 UTSW 13 58569415 splice site probably benign
R0838:Slc28a3 UTSW 13 58588269 missense probably benign 0.00
R1433:Slc28a3 UTSW 13 58563106 missense probably damaging 1.00
R1437:Slc28a3 UTSW 13 58558575 nonsense probably null
R3499:Slc28a3 UTSW 13 58573439 splice site probably benign
R3822:Slc28a3 UTSW 13 58558278 missense probably benign 0.00
R3948:Slc28a3 UTSW 13 58563010 splice site probably null
R4011:Slc28a3 UTSW 13 58566250 missense probably benign 0.06
R4028:Slc28a3 UTSW 13 58610756 missense probably benign 0.27
R4073:Slc28a3 UTSW 13 58559290 missense probably benign 0.01
R4745:Slc28a3 UTSW 13 58574263 missense possibly damaging 0.69
R4939:Slc28a3 UTSW 13 58558581 missense probably benign 0.44
R5416:Slc28a3 UTSW 13 58576793 missense probably damaging 0.99
R5421:Slc28a3 UTSW 13 58574265 missense possibly damaging 0.87
R5426:Slc28a3 UTSW 13 58563154 missense probably damaging 1.00
R5688:Slc28a3 UTSW 13 58558649 missense probably damaging 0.96
R6066:Slc28a3 UTSW 13 58578487 missense probably benign 0.00
R6790:Slc28a3 UTSW 13 58582650 missense probably benign 0.00
R6919:Slc28a3 UTSW 13 58573443 critical splice donor site probably null
R7009:Slc28a3 UTSW 13 58610804 missense probably benign 0.28
R7102:Slc28a3 UTSW 13 58588214 missense probably benign 0.04
R7305:Slc28a3 UTSW 13 58566231 missense possibly damaging 0.65
R7307:Slc28a3 UTSW 13 58563172 missense probably damaging 1.00
R7864:Slc28a3 UTSW 13 58578403 critical splice donor site probably null
R7963:Slc28a3 UTSW 13 58576766 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACACACCAAGTTACAGTG -3'
(R):5'- GCAGAATTCGAGGCAATCACTG -3'

Sequencing Primer
(F):5'- CCAACATATATTGTCATGGTG -3'
(R):5'- CGAGGCAATCACTGTTTAATGAGTG -3'
Posted On2019-10-07