Incidental Mutation 'R7464:Zfp748'
ID 578665
Institutional Source Beutler Lab
Gene Symbol Zfp748
Ensembl Gene ENSMUSG00000095432
Gene Name zinc finger protein 748
Synonyms KRAB-O, mszf54, Zfp208, 2610014M12Rik
MMRRC Submission 045538-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R7464 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 67686758-67701257 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67690091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 390 (C390R)
Ref Sequence ENSEMBL: ENSMUSP00000137928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181892]
AlphaFold Q7TPL6
Predicted Effect probably damaging
Transcript: ENSMUST00000181892
AA Change: C390R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137928
Gene: ENSMUSG00000095432
AA Change: C390R

DomainStartEndE-ValueType
KRAB 5 65 3.39e-35 SMART
ZnF_C2H2 81 101 1.59e1 SMART
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 165 187 5.14e-3 SMART
ZnF_C2H2 193 215 2.71e-2 SMART
ZnF_C2H2 277 298 7.37e1 SMART
ZnF_C2H2 304 326 1.95e-3 SMART
ZnF_C2H2 332 354 8.94e-3 SMART
ZnF_C2H2 360 382 2.61e-4 SMART
ZnF_C2H2 388 410 5.9e-3 SMART
ZnF_C2H2 416 438 3.44e-4 SMART
ZnF_C2H2 444 466 3.89e-3 SMART
ZnF_C2H2 472 494 4.79e-3 SMART
ZnF_C2H2 500 522 1.6e-4 SMART
ZnF_C2H2 528 550 1.18e-2 SMART
ZnF_C2H2 556 578 1.12e-3 SMART
ZnF_C2H2 584 606 3.89e-3 SMART
ZnF_C2H2 612 634 2.95e-3 SMART
ZnF_C2H2 640 662 1.6e-4 SMART
ZnF_C2H2 668 690 2.95e-3 SMART
ZnF_C2H2 696 718 2.12e-4 SMART
ZnF_C2H2 724 746 4.47e-3 SMART
ZnF_C2H2 752 774 1.12e-3 SMART
ZnF_C2H2 780 802 3.89e-3 SMART
ZnF_C2H2 808 830 1.47e-3 SMART
ZnF_C2H2 836 858 4.87e-4 SMART
ZnF_C2H2 864 886 7.9e-4 SMART
Meta Mutation Damage Score 0.2137 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,152 (GRCm39) G736R possibly damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Ankar A T 1: 72,738,053 (GRCm39) V43E possibly damaging Het
Apof A G 10: 128,105,505 (GRCm39) I220V probably benign Het
Asxl1 G T 2: 153,239,705 (GRCm39) A499S probably benign Het
Baz2a T A 10: 127,957,942 (GRCm39) D1069E possibly damaging Het
Baz2b T C 2: 59,807,792 (GRCm39) T156A possibly damaging Het
Bbc3 A T 7: 16,051,082 (GRCm39) R169W unknown Het
C5ar1 T A 7: 15,982,691 (GRCm39) I110L probably benign Het
Cd19 C A 7: 126,010,975 (GRCm39) R323L probably damaging Het
Cdc14b A T 13: 64,344,489 (GRCm39) C113* probably null Het
Cngb1 C A 8: 95,980,811 (GRCm39) W914L possibly damaging Het
Colgalt2 A G 1: 152,379,895 (GRCm39) K445E probably damaging Het
Crebrf A G 17: 26,982,461 (GRCm39) M608V unknown Het
Csf1 T A 3: 107,656,191 (GRCm39) H280L probably benign Het
Cyp2j11 C A 4: 96,233,357 (GRCm39) R113L probably damaging Het
D5Ertd579e G A 5: 36,771,129 (GRCm39) H1089Y probably damaging Het
Ddx60 C T 8: 62,393,708 (GRCm39) T48M possibly damaging Het
Defa40 T A 8: 21,739,910 (GRCm39) S45T probably damaging Het
Dock10 T C 1: 80,518,032 (GRCm39) D1315G probably damaging Het
Dock2 T G 11: 34,586,105 (GRCm39) N526H probably damaging Het
Dram2 T C 3: 106,480,999 (GRCm39) *268Q probably null Het
Emc8 A G 8: 121,394,657 (GRCm39) Y21H possibly damaging Het
Fam162a A G 16: 35,891,863 (GRCm39) L4P probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fbxw10 T A 11: 62,744,124 (GRCm39) I307N probably benign Het
Fbxw16 A G 9: 109,268,619 (GRCm39) V257A possibly damaging Het
Fer1l6 T A 15: 58,445,096 (GRCm39) probably null Het
Galnt7 A G 8: 58,037,054 (GRCm39) Y112H possibly damaging Het
Gigyf2 T C 1: 87,356,326 (GRCm39) I803T unknown Het
Gm28729 A G 9: 96,403,288 (GRCm39) I44T possibly damaging Het
Gm5447 A G 13: 31,158,377 (GRCm39) I34V not run Het
H2-M9 A T 17: 36,953,303 (GRCm39) probably null Het
Helz G A 11: 107,527,104 (GRCm39) C864Y probably damaging Het
Il25 A G 14: 55,170,679 (GRCm39) Y84C probably null Het
Itga10 T A 3: 96,555,471 (GRCm39) C142S probably damaging Het
Kcna10 A T 3: 107,101,395 (GRCm39) M9L probably damaging Het
Klhl6 G T 16: 19,775,863 (GRCm39) Q232K possibly damaging Het
Mb21d2 T G 16: 28,748,298 (GRCm39) I40L possibly damaging Het
Mdm1 T C 10: 117,988,171 (GRCm39) S334P probably benign Het
Mllt10 T A 2: 18,175,090 (GRCm39) D549E probably benign Het
Mlxipl T C 5: 135,162,482 (GRCm39) V648A probably benign Het
Nars2 A G 7: 96,689,137 (GRCm39) K353R probably benign Het
Nav1 T A 1: 135,512,647 (GRCm39) M138L probably benign Het
Neb T C 2: 52,083,902 (GRCm39) T5635A probably benign Het
Nktr A C 9: 121,579,393 (GRCm39) I1154L unknown Het
Or14j8 A T 17: 38,263,171 (GRCm39) V248D probably damaging Het
Or2a57 T G 6: 43,213,228 (GRCm39) S229A probably damaging Het
Or4g17 T A 2: 111,209,543 (GRCm39) L66Q probably damaging Het
Oxld1 T C 11: 120,347,963 (GRCm39) D78G probably benign Het
Pde1b T C 15: 103,433,256 (GRCm39) I255T probably benign Het
Pkp4 T A 2: 59,138,481 (GRCm39) F244I probably benign Het
Polg2 C A 11: 106,664,540 (GRCm39) V305L probably benign Het
Pramel34 C T 5: 93,784,099 (GRCm39) C455Y probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Sash1 T C 10: 8,632,509 (GRCm39) D242G possibly damaging Het
Six4 T C 12: 73,159,304 (GRCm39) T219A possibly damaging Het
Slc28a3 A C 13: 58,710,835 (GRCm39) Y562* probably null Het
Soat1 A T 1: 156,266,887 (GRCm39) W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Spef2 T C 15: 9,740,671 (GRCm39) N30D probably benign Het
Spopfm2 A T 3: 94,083,411 (GRCm39) N133K probably benign Het
Srebf2 T A 15: 82,057,075 (GRCm39) I270N probably damaging Het
St8sia3 T C 18: 64,404,589 (GRCm39) W289R probably damaging Het
Stx5a T A 19: 8,720,868 (GRCm39) probably benign Het
Tacc1 T C 8: 25,654,480 (GRCm39) D689G probably damaging Het
Tacc3 A G 5: 33,818,628 (GRCm39) D21G probably benign Het
Tapt1 G A 5: 44,346,030 (GRCm39) R307* probably null Het
Tbc1d9b T A 11: 50,022,312 (GRCm39) V16E probably damaging Het
Tchhl1 G A 3: 93,377,971 (GRCm39) R225K probably benign Het
Thumpd3 G A 6: 113,032,730 (GRCm39) G156D probably benign Het
Tmem178 C T 17: 81,252,331 (GRCm39) P72S probably benign Het
Tmem52 C T 4: 155,553,926 (GRCm39) P46S probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tulp3 A T 6: 128,303,792 (GRCm39) V269D probably benign Het
Ubr1 A G 2: 120,720,255 (GRCm39) probably null Het
Upf1 G A 8: 70,786,073 (GRCm39) S962L probably benign Het
Vcpip1 C T 1: 9,816,745 (GRCm39) R546Q probably damaging Het
Vmn2r49 A C 7: 9,722,820 (GRCm39) S151R probably benign Het
Wac T C 18: 7,871,746 (GRCm39) probably null Het
Wrn C T 8: 33,826,024 (GRCm39) probably null Het
Zfp286 C A 11: 62,671,627 (GRCm39) D149Y probably benign Het
Zfp873 A G 10: 81,896,210 (GRCm39) T314A possibly damaging Het
Zfyve1 C T 12: 83,598,261 (GRCm39) D656N probably benign Het
Zmym1 T A 4: 126,952,728 (GRCm39) K18* probably null Het
Other mutations in Zfp748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Zfp748 APN 13 67,693,546 (GRCm39) splice site probably benign
R0440:Zfp748 UTSW 13 67,701,144 (GRCm39) splice site probably null
R0790:Zfp748 UTSW 13 67,693,481 (GRCm39) missense probably benign 0.03
R1760:Zfp748 UTSW 13 67,693,540 (GRCm39) critical splice acceptor site probably null
R2520:Zfp748 UTSW 13 67,694,781 (GRCm39) missense possibly damaging 0.84
R3711:Zfp748 UTSW 13 67,688,915 (GRCm39) missense probably damaging 1.00
R4157:Zfp748 UTSW 13 67,690,225 (GRCm39) missense possibly damaging 0.80
R4288:Zfp748 UTSW 13 67,689,202 (GRCm39) missense probably damaging 1.00
R4289:Zfp748 UTSW 13 67,689,202 (GRCm39) missense probably damaging 1.00
R5091:Zfp748 UTSW 13 67,689,638 (GRCm39) missense probably damaging 1.00
R5441:Zfp748 UTSW 13 67,688,737 (GRCm39) missense probably damaging 1.00
R5686:Zfp748 UTSW 13 67,690,647 (GRCm39) nonsense probably null
R5907:Zfp748 UTSW 13 67,689,292 (GRCm39) missense possibly damaging 0.87
R6210:Zfp748 UTSW 13 67,688,923 (GRCm39) missense possibly damaging 0.85
R6268:Zfp748 UTSW 13 67,690,705 (GRCm39) missense possibly damaging 0.77
R6639:Zfp748 UTSW 13 67,691,024 (GRCm39) missense probably damaging 1.00
R6810:Zfp748 UTSW 13 67,689,844 (GRCm39) missense probably damaging 1.00
R7148:Zfp748 UTSW 13 67,690,358 (GRCm39) missense possibly damaging 0.96
R7593:Zfp748 UTSW 13 67,690,638 (GRCm39) missense probably benign 0.20
R7644:Zfp748 UTSW 13 67,689,568 (GRCm39) missense probably damaging 0.99
R7799:Zfp748 UTSW 13 67,689,608 (GRCm39) missense probably benign 0.02
R8872:Zfp748 UTSW 13 67,689,914 (GRCm39) missense probably damaging 1.00
R9140:Zfp748 UTSW 13 67,689,073 (GRCm39) missense probably damaging 1.00
R9402:Zfp748 UTSW 13 67,693,511 (GRCm39) missense probably benign 0.33
R9649:Zfp748 UTSW 13 67,690,647 (GRCm39) nonsense probably null
R9687:Zfp748 UTSW 13 67,690,471 (GRCm39) missense probably benign 0.00
R9749:Zfp748 UTSW 13 67,690,573 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTCATCACACCTGTACGG -3'
(R):5'- GGCAATGCCTTTTGTACACTCC -3'

Sequencing Primer
(F):5'- ACGGTTTCTCTCCAGAATGAATTGC -3'
(R):5'- CCCTGATTCAGCATAAGATAGGTC -3'
Posted On 2019-10-07