Mutagenetix > Incidental Mutations

Incidental Mutation 'R7464:Spef2'

578667

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R7464 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9740585 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 30 (N30D)

Ref Sequence

ENSEMBL: ENSMUSP00000035762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]

Predicted Effect

probably benign
Transcript: ENSMUST00000041840
AA Change: N30D

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: N30D

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159093
AA Change: N30D

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: N30D

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159368
AA Change: N30D

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: N30D

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	162	1.4e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160236
AA Change: N30D

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: N30D

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162780
AA Change: N30D

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: N30D

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	164	1.1e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208854
AA Change: N30D

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (79/82)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	C	T	6: 23,077,153	G736R	possibly damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Ankar	A	T	1: 72,698,894	V43E	possibly damaging	Het
Apof	A	G	10: 128,269,636	I220V	probably benign	Het
Asxl1	G	T	2: 153,397,785	A499S	probably benign	Het
Baz2a	T	A	10: 128,122,073	D1069E	possibly damaging	Het
Baz2b	T	C	2: 59,977,448	T156A	possibly damaging	Het
Bbc3	A	T	7: 16,317,157	R169W	unknown	Het
C5ar1	T	A	7: 16,248,766	I110L	probably benign	Het
C87414	C	T	5: 93,636,240	C455Y	probably damaging	Het
Cd19	C	A	7: 126,411,803	R323L	probably damaging	Het
Cdc14b	A	T	13: 64,196,675	C113*	probably null	Het
Cngb1	C	A	8: 95,254,183	W914L	possibly damaging	Het
Colgalt2	A	G	1: 152,504,144	K445E	probably damaging	Het
Crebrf	A	G	17: 26,763,487	M608V	unknown	Het
Csf1	T	A	3: 107,748,875	H280L	probably benign	Het
Cyp2j11	C	A	4: 96,345,120	R113L	probably damaging	Het
D5Ertd579e	G	A	5: 36,613,785	H1089Y	probably damaging	Het
Ddx60	C	T	8: 61,940,674	T48M	possibly damaging	Het
Dock10	T	C	1: 80,540,315	D1315G	probably damaging	Het
Dock2	T	G	11: 34,695,278	N526H	probably damaging	Het
Dram2	T	C	3: 106,573,683	*268Q	probably null	Het
Emc8	A	G	8: 120,667,918	Y21H	possibly damaging	Het
Fam162a	A	G	16: 36,071,493	L4P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbxw10	T	A	11: 62,853,298	I307N	probably benign	Het
Fbxw16	A	G	9: 109,439,551	V257A	possibly damaging	Het
Fer1l6	T	A	15: 58,573,247		probably null	Het
Galnt7	A	G	8: 57,584,020	Y112H	possibly damaging	Het
Gigyf2	T	C	1: 87,428,604	I803T	unknown	Het
Gm10696	A	T	3: 94,176,104	N133K	probably benign	Het
Gm15292	T	A	8: 21,249,894	S45T	probably damaging	Het
Gm28729	A	G	9: 96,521,235	I44T	possibly damaging	Het
Gm5447	A	G	13: 30,974,394	I34V	not run	Het
H2-M9	A	T	17: 36,642,411		probably null	Het
Helz	G	A	11: 107,636,278	C864Y	probably damaging	Het
Il25	A	G	14: 54,933,222	Y84C	probably null	Het
Itga10	T	A	3: 96,648,155	C142S	probably damaging	Het
Kcna10	A	T	3: 107,194,079	M9L	probably damaging	Het
Klhl6	G	T	16: 19,957,113	Q232K	possibly damaging	Het
Mb21d2	T	G	16: 28,929,546	I40L	possibly damaging	Het
Mdm1	T	C	10: 118,152,266	S334P	probably benign	Het
Mllt10	T	A	2: 18,170,279	D549E	probably benign	Het
Mlxipl	T	C	5: 135,133,628	V648A	probably benign	Het
Nars2	A	G	7: 97,039,930	K353R	probably benign	Het
Nav1	T	A	1: 135,584,909	M138L	probably benign	Het
Neb	T	C	2: 52,193,890	T5635A	probably benign	Het
Nktr	A	C	9: 121,750,327	I1154L	unknown	Het
Olfr1284	T	A	2: 111,379,198	L66Q	probably damaging	Het
Olfr47	T	G	6: 43,236,294	S229A	probably damaging	Het
Olfr761	A	T	17: 37,952,280	V248D	probably damaging	Het
Oxld1	T	C	11: 120,457,137	D78G	probably benign	Het
Pde1b	T	C	15: 103,524,829	I255T	probably benign	Het
Pkp4	T	A	2: 59,308,137	F244I	probably benign	Het
Polg2	C	A	11: 106,773,714	V305L	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Sash1	T	C	10: 8,756,745	D242G	possibly damaging	Het
Six4	T	C	12: 73,112,530	T219A	possibly damaging	Het
Slc28a3	A	C	13: 58,563,021	Y562*	probably null	Het
Soat1	A	T	1: 156,439,317	W310R	probably damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Srebf2	T	A	15: 82,172,874	I270N	probably damaging	Het
St8sia3	T	C	18: 64,271,518	W289R	probably damaging	Het
Stx5a	T	A	19: 8,743,504		probably benign	Het
Tacc1	T	C	8: 25,164,464	D689G	probably damaging	Het
Tacc3	A	G	5: 33,661,284	D21G	probably benign	Het
Tapt1	G	A	5: 44,188,688	R307*	probably null	Het
Tbc1d9b	T	A	11: 50,131,485	V16E	probably damaging	Het
Tchhl1	G	A	3: 93,470,664	R225K	probably benign	Het
Thumpd3	G	A	6: 113,055,769	G156D	probably benign	Het
Tmem178	C	T	17: 80,944,902	P72S	probably benign	Het
Tmem52	C	T	4: 155,469,469	P46S	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tulp3	A	T	6: 128,326,829	V269D	probably benign	Het
Ubr1	A	G	2: 120,889,774		probably null	Het
Upf1	G	A	8: 70,333,423	S962L	probably benign	Het
Vcpip1	C	T	1: 9,746,520	R546Q	probably damaging	Het
Vmn2r49	A	C	7: 9,988,893	S151R	probably benign	Het
Wac	T	C	18: 7,871,746		probably null	Het
Wrn	C	T	8: 33,335,996		probably null	Het
Zfp286	C	A	11: 62,780,801	D149Y	probably benign	Het
Zfp748	A	G	13: 67,541,972	C390R	probably damaging	Het
Zfp873	A	G	10: 82,060,376	T314A	possibly damaging	Het
Zfyve1	C	T	12: 83,551,487	D656N	probably benign	Het
Zmym1	T	A	4: 127,058,935	K18*	probably null	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	splice site	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9601085	missense	unknown
R8105:Spef2	UTSW	15	9682662	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9601512	missense	unknown
R8296:Spef2	UTSW	15	9727543	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9676529	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9612557	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9600679	intron	probably benign
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTCCTTGTAAACACATTCGTTC -3'
(R):5'- TATCAACTACTGGTTTACCTTTGGG -3'

Sequencing Primer
(F):5'- CTTCTCCTTTGGATTCTCGAGACAAC -3'
(R):5'- GTTCCAGGCATTGTATGG -3'

Posted On

2019-10-07