Incidental Mutation 'R7464:Or14j8'
ID 578675
Institutional Source Beutler Lab
Gene Symbol Or14j8
Ensembl Gene ENSMUSG00000109376
Gene Name olfactory receptor family 14 subfamily J member 8
Synonyms Olfr1552-ps1, MOR218-6P, GA_x6K02T2PSCP-2403971-2403000, Olfr761, MOR218-12, MOR218-5P, MOR218-6P
MMRRC Submission 045538-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.784) question?
Stock # R7464 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 38262942-38263913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38263171 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 248 (V248D)
Ref Sequence ENSEMBL: ENSMUSP00000092917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049620]
AlphaFold Q7TRJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000049620
AA Change: V248D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092917
Gene: ENSMUSG00000109376
AA Change: V248D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 3.7e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,152 (GRCm39) G736R possibly damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Ankar A T 1: 72,738,053 (GRCm39) V43E possibly damaging Het
Apof A G 10: 128,105,505 (GRCm39) I220V probably benign Het
Asxl1 G T 2: 153,239,705 (GRCm39) A499S probably benign Het
Baz2a T A 10: 127,957,942 (GRCm39) D1069E possibly damaging Het
Baz2b T C 2: 59,807,792 (GRCm39) T156A possibly damaging Het
Bbc3 A T 7: 16,051,082 (GRCm39) R169W unknown Het
C5ar1 T A 7: 15,982,691 (GRCm39) I110L probably benign Het
Cd19 C A 7: 126,010,975 (GRCm39) R323L probably damaging Het
Cdc14b A T 13: 64,344,489 (GRCm39) C113* probably null Het
Cngb1 C A 8: 95,980,811 (GRCm39) W914L possibly damaging Het
Colgalt2 A G 1: 152,379,895 (GRCm39) K445E probably damaging Het
Crebrf A G 17: 26,982,461 (GRCm39) M608V unknown Het
Csf1 T A 3: 107,656,191 (GRCm39) H280L probably benign Het
Cyp2j11 C A 4: 96,233,357 (GRCm39) R113L probably damaging Het
D5Ertd579e G A 5: 36,771,129 (GRCm39) H1089Y probably damaging Het
Ddx60 C T 8: 62,393,708 (GRCm39) T48M possibly damaging Het
Defa40 T A 8: 21,739,910 (GRCm39) S45T probably damaging Het
Dock10 T C 1: 80,518,032 (GRCm39) D1315G probably damaging Het
Dock2 T G 11: 34,586,105 (GRCm39) N526H probably damaging Het
Dram2 T C 3: 106,480,999 (GRCm39) *268Q probably null Het
Emc8 A G 8: 121,394,657 (GRCm39) Y21H possibly damaging Het
Fam162a A G 16: 35,891,863 (GRCm39) L4P probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fbxw10 T A 11: 62,744,124 (GRCm39) I307N probably benign Het
Fbxw16 A G 9: 109,268,619 (GRCm39) V257A possibly damaging Het
Fer1l6 T A 15: 58,445,096 (GRCm39) probably null Het
Galnt7 A G 8: 58,037,054 (GRCm39) Y112H possibly damaging Het
Gigyf2 T C 1: 87,356,326 (GRCm39) I803T unknown Het
Gm28729 A G 9: 96,403,288 (GRCm39) I44T possibly damaging Het
Gm5447 A G 13: 31,158,377 (GRCm39) I34V not run Het
H2-M9 A T 17: 36,953,303 (GRCm39) probably null Het
Helz G A 11: 107,527,104 (GRCm39) C864Y probably damaging Het
Il25 A G 14: 55,170,679 (GRCm39) Y84C probably null Het
Itga10 T A 3: 96,555,471 (GRCm39) C142S probably damaging Het
Kcna10 A T 3: 107,101,395 (GRCm39) M9L probably damaging Het
Klhl6 G T 16: 19,775,863 (GRCm39) Q232K possibly damaging Het
Mb21d2 T G 16: 28,748,298 (GRCm39) I40L possibly damaging Het
Mdm1 T C 10: 117,988,171 (GRCm39) S334P probably benign Het
Mllt10 T A 2: 18,175,090 (GRCm39) D549E probably benign Het
Mlxipl T C 5: 135,162,482 (GRCm39) V648A probably benign Het
Nars2 A G 7: 96,689,137 (GRCm39) K353R probably benign Het
Nav1 T A 1: 135,512,647 (GRCm39) M138L probably benign Het
Neb T C 2: 52,083,902 (GRCm39) T5635A probably benign Het
Nktr A C 9: 121,579,393 (GRCm39) I1154L unknown Het
Or2a57 T G 6: 43,213,228 (GRCm39) S229A probably damaging Het
Or4g17 T A 2: 111,209,543 (GRCm39) L66Q probably damaging Het
Oxld1 T C 11: 120,347,963 (GRCm39) D78G probably benign Het
Pde1b T C 15: 103,433,256 (GRCm39) I255T probably benign Het
Pkp4 T A 2: 59,138,481 (GRCm39) F244I probably benign Het
Polg2 C A 11: 106,664,540 (GRCm39) V305L probably benign Het
Pramel34 C T 5: 93,784,099 (GRCm39) C455Y probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Sash1 T C 10: 8,632,509 (GRCm39) D242G possibly damaging Het
Six4 T C 12: 73,159,304 (GRCm39) T219A possibly damaging Het
Slc28a3 A C 13: 58,710,835 (GRCm39) Y562* probably null Het
Soat1 A T 1: 156,266,887 (GRCm39) W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Spef2 T C 15: 9,740,671 (GRCm39) N30D probably benign Het
Spopfm2 A T 3: 94,083,411 (GRCm39) N133K probably benign Het
Srebf2 T A 15: 82,057,075 (GRCm39) I270N probably damaging Het
St8sia3 T C 18: 64,404,589 (GRCm39) W289R probably damaging Het
Stx5a T A 19: 8,720,868 (GRCm39) probably benign Het
Tacc1 T C 8: 25,654,480 (GRCm39) D689G probably damaging Het
Tacc3 A G 5: 33,818,628 (GRCm39) D21G probably benign Het
Tapt1 G A 5: 44,346,030 (GRCm39) R307* probably null Het
Tbc1d9b T A 11: 50,022,312 (GRCm39) V16E probably damaging Het
Tchhl1 G A 3: 93,377,971 (GRCm39) R225K probably benign Het
Thumpd3 G A 6: 113,032,730 (GRCm39) G156D probably benign Het
Tmem178 C T 17: 81,252,331 (GRCm39) P72S probably benign Het
Tmem52 C T 4: 155,553,926 (GRCm39) P46S probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tulp3 A T 6: 128,303,792 (GRCm39) V269D probably benign Het
Ubr1 A G 2: 120,720,255 (GRCm39) probably null Het
Upf1 G A 8: 70,786,073 (GRCm39) S962L probably benign Het
Vcpip1 C T 1: 9,816,745 (GRCm39) R546Q probably damaging Het
Vmn2r49 A C 7: 9,722,820 (GRCm39) S151R probably benign Het
Wac T C 18: 7,871,746 (GRCm39) probably null Het
Wrn C T 8: 33,826,024 (GRCm39) probably null Het
Zfp286 C A 11: 62,671,627 (GRCm39) D149Y probably benign Het
Zfp748 A G 13: 67,690,091 (GRCm39) C390R probably damaging Het
Zfp873 A G 10: 81,896,210 (GRCm39) T314A possibly damaging Het
Zfyve1 C T 12: 83,598,261 (GRCm39) D656N probably benign Het
Zmym1 T A 4: 126,952,728 (GRCm39) K18* probably null Het
Other mutations in Or14j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Or14j8 APN 17 38,263,742 (GRCm39) missense probably damaging 1.00
IGL02104:Or14j8 APN 17 38,263,182 (GRCm39) missense probably damaging 1.00
IGL02431:Or14j8 APN 17 38,263,413 (GRCm39) missense probably benign 0.06
IGL02649:Or14j8 APN 17 38,263,864 (GRCm39) missense probably damaging 1.00
IGL03109:Or14j8 APN 17 38,263,378 (GRCm39) missense probably damaging 1.00
IGL03261:Or14j8 APN 17 38,263,697 (GRCm39) missense possibly damaging 0.76
R0898:Or14j8 UTSW 17 38,263,127 (GRCm39) missense probably benign 0.17
R1373:Or14j8 UTSW 17 38,263,251 (GRCm39) missense probably damaging 1.00
R1527:Or14j8 UTSW 17 38,263,720 (GRCm39) missense possibly damaging 0.88
R1664:Or14j8 UTSW 17 38,263,784 (GRCm39) missense probably benign 0.44
R1835:Or14j8 UTSW 17 38,263,276 (GRCm39) missense possibly damaging 0.79
R4124:Or14j8 UTSW 17 38,263,681 (GRCm39) missense probably benign 0.16
R4125:Or14j8 UTSW 17 38,263,681 (GRCm39) missense probably benign 0.16
R4128:Or14j8 UTSW 17 38,263,681 (GRCm39) missense probably benign 0.16
R4534:Or14j8 UTSW 17 38,263,613 (GRCm39) missense probably benign
R4557:Or14j8 UTSW 17 38,263,142 (GRCm39) missense probably benign 0.10
R4790:Or14j8 UTSW 17 38,263,633 (GRCm39) missense probably damaging 0.99
R4856:Or14j8 UTSW 17 38,262,962 (GRCm39) missense probably benign 0.15
R4886:Or14j8 UTSW 17 38,262,962 (GRCm39) missense probably benign 0.15
R4955:Or14j8 UTSW 17 38,263,789 (GRCm39) missense probably damaging 1.00
R5162:Or14j8 UTSW 17 38,263,255 (GRCm39) missense probably benign 0.00
R6016:Or14j8 UTSW 17 38,262,967 (GRCm39) missense probably benign 0.13
R6282:Or14j8 UTSW 17 38,263,315 (GRCm39) missense possibly damaging 0.80
R7018:Or14j8 UTSW 17 38,263,393 (GRCm39) missense probably damaging 1.00
R7199:Or14j8 UTSW 17 38,263,048 (GRCm39) missense probably damaging 1.00
R7340:Or14j8 UTSW 17 38,263,413 (GRCm39) missense probably benign 0.06
R7360:Or14j8 UTSW 17 38,263,900 (GRCm39) missense probably damaging 1.00
R7974:Or14j8 UTSW 17 38,263,672 (GRCm39) missense probably damaging 1.00
R8719:Or14j8 UTSW 17 38,263,895 (GRCm39) missense probably damaging 0.97
R8738:Or14j8 UTSW 17 38,263,673 (GRCm39) missense possibly damaging 0.79
R8817:Or14j8 UTSW 17 38,263,273 (GRCm39) missense probably damaging 0.99
R8856:Or14j8 UTSW 17 38,263,091 (GRCm39) missense possibly damaging 0.87
R9006:Or14j8 UTSW 17 38,263,545 (GRCm39) nonsense probably null
R9432:Or14j8 UTSW 17 38,263,559 (GRCm39) missense probably damaging 1.00
X0064:Or14j8 UTSW 17 38,263,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCCAGTGTTAGCAGGCAC -3'
(R):5'- GCTCTCCTGCTCTAATGATGAC -3'

Sequencing Primer
(F):5'- TCCAGTGTTAGCAGGCACTAAAAAC -3'
(R):5'- CTGCTCTAATGATGACTTTGGAGTAC -3'
Posted On 2019-10-07