Incidental Mutation 'R7465:Irgq'
ID578703
Institutional Source Beutler Lab
Gene Symbol Irgq
Ensembl Gene ENSMUSG00000041037
Gene Nameimmunity-related GTPase family, Q
SynonymsFKSG27
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7465 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24530689-24538600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24534409 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 558 (H558Q)
Ref Sequence ENSEMBL: ENSMUSP00000036699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049020]
Predicted Effect probably damaging
Transcript: ENSMUST00000049020
AA Change: H558Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036699
Gene: ENSMUSG00000041037
AA Change: H558Q

DomainStartEndE-ValueType
SCOP:d4tmka_ 12 61 7e-3 SMART
low complexity region 64 75 N/A INTRINSIC
low complexity region 92 112 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 409 455 N/A INTRINSIC
low complexity region 520 538 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a A T 13: 30,381,981 D343V probably benign Het
Anks1 G A 17: 28,054,323 R972Q possibly damaging Het
Atp2a2 T C 5: 122,461,700 K543E probably benign Het
Atp8b5 G A 4: 43,271,269 V4I probably benign Het
Bcar3 A T 3: 122,523,230 N617Y probably benign Het
Blm A G 7: 80,513,115 S163P probably benign Het
Cbx3 A G 6: 51,478,530 D87G probably benign Het
Celsr1 A G 15: 86,033,392 S127P probably benign Het
Cndp1 A T 18: 84,619,541 M356K probably damaging Het
Cnn2 G A 10: 79,992,527 E113K probably damaging Het
Col17a1 T A 19: 47,668,105 R573* probably null Het
Cttnbp2 T A 6: 18,501,992 E49V probably damaging Het
Dynlrb2 T A 8: 116,514,957 V80E possibly damaging Het
Ehbp1 A G 11: 22,138,001 V386A probably benign Het
Elfn1 C T 5: 139,972,087 P282L probably benign Het
Fam69a T C 5: 107,909,684 D336G probably damaging Het
Fan1 G A 7: 64,353,638 T812I probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat1 G A 8: 45,044,152 V4225I probably benign Het
Frem1 A G 4: 82,914,835 C1873R probably benign Het
Fsd1l T C 4: 53,647,755 I66T probably benign Het
Gabrr1 C A 4: 33,146,970 D52E probably benign Het
Il18rap T C 1: 40,543,089 L390P probably damaging Het
Il27ra T A 8: 84,039,612 D181V probably benign Het
Itsn2 C T 12: 4,706,983 Q1358* probably null Het
Kmt2c C T 5: 25,302,849 G3197S probably damaging Het
Lrrk2 A G 15: 91,767,340 Y1733C probably damaging Het
Mapk7 G A 11: 61,490,453 A510V probably damaging Het
Mtch1 A T 17: 29,332,724 C385S probably benign Het
Nfib A G 4: 82,353,521 probably null Het
Nostrin C T 2: 69,185,507 T448M possibly damaging Het
Olfr1066 A G 2: 86,455,806 V155A probably benign Het
Olfr1255 T C 2: 89,816,536 L64P probably damaging Het
Olfr1436 T C 19: 12,298,437 I232V probably benign Het
Olfr1441 T A 19: 12,423,145 Y279N probably damaging Het
Olfr533 T A 7: 140,466,798 V199D probably damaging Het
Olfr670 A G 7: 104,959,917 Y272H probably benign Het
Pcdha2 T C 18: 36,940,330 V338A probably damaging Het
Pcdhgc3 A G 18: 37,807,745 T400A probably benign Het
Piezo2 C T 18: 63,012,723 S2710N probably benign Het
Ppp4r1 T A 17: 65,831,020 Y591* probably null Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rab42 T C 4: 132,302,614 E99G possibly damaging Het
Rd3l A T 12: 111,979,482 W188R probably damaging Het
Sap30bp A G 11: 115,951,968 D89G probably benign Het
Sptbn4 T C 7: 27,366,689 T1985A probably benign Het
Tec T C 5: 72,773,880 Y247C probably damaging Het
Tek G A 4: 94,827,826 probably null Het
Tex14 T C 11: 87,514,430 S723P possibly damaging Het
Thumpd3 T A 6: 113,047,631 L62Q probably damaging Het
Tlr12 A T 4: 128,616,170 D762E probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Txndc16 T A 14: 45,165,388 I316F probably damaging Het
Vamp1 T C 6: 125,218,575 S2P unknown Het
Vmn1r211 T A 13: 22,851,916 M194L probably benign Het
Zfp874a T A 13: 67,442,257 Q436L probably damaging Het
Other mutations in Irgq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Irgq APN 7 24533724 missense probably damaging 1.00
IGL02639:Irgq APN 7 24531462 missense probably damaging 1.00
R4222:Irgq UTSW 7 24533625 missense possibly damaging 0.79
R4806:Irgq UTSW 7 24534045 missense probably damaging 1.00
R5831:Irgq UTSW 7 24533338 missense probably damaging 0.96
R5980:Irgq UTSW 7 24533345 missense probably damaging 1.00
R6460:Irgq UTSW 7 24533690 missense probably benign 0.00
R6802:Irgq UTSW 7 24531651 missense probably benign
R7173:Irgq UTSW 7 24533760 missense probably damaging 0.99
R8350:Irgq UTSW 7 24533740 missense probably benign 0.00
R8409:Irgq UTSW 7 24533784 missense probably benign
R8470:Irgq UTSW 7 24534290 missense probably damaging 1.00
Z1176:Irgq UTSW 7 24531801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGGCATCGGGGACT -3'
(R):5'- CCTTCAAGTCTCCGGGTTTGA -3'

Sequencing Primer
(F):5'- TCCCGGAGTACTGGCAAC -3'
(R):5'- CAAGTCTCCGGGTTTGAATAAC -3'
Posted On2019-10-07