Incidental Mutation 'R7465:Sptbn4'
ID578704
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R7465 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27366689 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1985 (T1985A)
Ref Sequence ENSEMBL: ENSMUSP00000011895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect probably benign
Transcript: ENSMUST00000011895
AA Change: T1985A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: T1985A

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108362
AA Change: T665A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: T665A

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108363
AA Change: T665A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: T665A

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108364
AA Change: T665A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: T665A

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172269
AA Change: T1980A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: T1980A

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a A T 13: 30,381,981 D343V probably benign Het
Anks1 G A 17: 28,054,323 R972Q possibly damaging Het
Atp2a2 T C 5: 122,461,700 K543E probably benign Het
Atp8b5 G A 4: 43,271,269 V4I probably benign Het
Bcar3 A T 3: 122,523,230 N617Y probably benign Het
Blm A G 7: 80,513,115 S163P probably benign Het
Cbx3 A G 6: 51,478,530 D87G probably benign Het
Celsr1 A G 15: 86,033,392 S127P probably benign Het
Cndp1 A T 18: 84,619,541 M356K probably damaging Het
Cnn2 G A 10: 79,992,527 E113K probably damaging Het
Col17a1 T A 19: 47,668,105 R573* probably null Het
Cttnbp2 T A 6: 18,501,992 E49V probably damaging Het
Dynlrb2 T A 8: 116,514,957 V80E possibly damaging Het
Ehbp1 A G 11: 22,138,001 V386A probably benign Het
Elfn1 C T 5: 139,972,087 P282L probably benign Het
Fam69a T C 5: 107,909,684 D336G probably damaging Het
Fan1 G A 7: 64,353,638 T812I probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat1 G A 8: 45,044,152 V4225I probably benign Het
Frem1 A G 4: 82,914,835 C1873R probably benign Het
Fsd1l T C 4: 53,647,755 I66T probably benign Het
Gabrr1 C A 4: 33,146,970 D52E probably benign Het
Il18rap T C 1: 40,543,089 L390P probably damaging Het
Il27ra T A 8: 84,039,612 D181V probably benign Het
Irgq C A 7: 24,534,409 H558Q probably damaging Het
Itsn2 C T 12: 4,706,983 Q1358* probably null Het
Kmt2c C T 5: 25,302,849 G3197S probably damaging Het
Lrrk2 A G 15: 91,767,340 Y1733C probably damaging Het
Mapk7 G A 11: 61,490,453 A510V probably damaging Het
Mtch1 A T 17: 29,332,724 C385S probably benign Het
Nfib A G 4: 82,353,521 probably null Het
Nostrin C T 2: 69,185,507 T448M possibly damaging Het
Olfr1066 A G 2: 86,455,806 V155A probably benign Het
Olfr1255 T C 2: 89,816,536 L64P probably damaging Het
Olfr1436 T C 19: 12,298,437 I232V probably benign Het
Olfr1441 T A 19: 12,423,145 Y279N probably damaging Het
Olfr533 T A 7: 140,466,798 V199D probably damaging Het
Olfr670 A G 7: 104,959,917 Y272H probably benign Het
Pcdha2 T C 18: 36,940,330 V338A probably damaging Het
Pcdhgc3 A G 18: 37,807,745 T400A probably benign Het
Piezo2 C T 18: 63,012,723 S2710N probably benign Het
Ppp4r1 T A 17: 65,831,020 Y591* probably null Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rab42 T C 4: 132,302,614 E99G possibly damaging Het
Rd3l A T 12: 111,979,482 W188R probably damaging Het
Sap30bp A G 11: 115,951,968 D89G probably benign Het
Smok2a A G 17: 13,226,055 K173R probably benign Het
Tec T C 5: 72,773,880 Y247C probably damaging Het
Tek G A 4: 94,827,826 probably null Het
Tex14 T C 11: 87,514,430 S723P possibly damaging Het
Thumpd3 T A 6: 113,047,631 L62Q probably damaging Het
Tlr12 A T 4: 128,616,170 D762E probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Txndc16 T A 14: 45,165,388 I316F probably damaging Het
Vamp1 T C 6: 125,218,575 S2P unknown Het
Vmn1r211 T A 13: 22,851,916 M194L probably benign Het
Zfp874a T A 13: 67,442,257 Q436L probably damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0194:Sptbn4 UTSW 7 27404911 missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1906:Sptbn4 UTSW 7 27391431 critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27423798 missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6762:Sptbn4 UTSW 7 27394208 missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
R7471:Sptbn4 UTSW 7 27409014 missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27428268 missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27375590 missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27442535 missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27372272 missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27361577 missense possibly damaging 0.80
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCTAGGTACCAGGTATGC -3'
(R):5'- TTCGGGTCACTGACTTAATGAAG -3'

Sequencing Primer
(F):5'- GCTAGGTACCAGGTATGCAAAAG -3'
(R):5'- GGTCACTGACTTAATGAAGACCCTG -3'
Posted On2019-10-07