Incidental Mutation 'R7465:Olfr1436'
ID578735
Institutional Source Beutler Lab
Gene Symbol Olfr1436
Ensembl Gene ENSMUSG00000067513
Gene Nameolfactory receptor 1436
SynonymsGA_x6K02T2RE5P-2634596-2633658, MOR214-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7465 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12298183-12299130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12298437 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 232 (I232V)
Ref Sequence ENSEMBL: ENSMUSP00000085113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087812]
Predicted Effect probably benign
Transcript: ENSMUST00000087812
AA Change: I232V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: I232V

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a A T 13: 30,381,981 D343V probably benign Het
Anks1 G A 17: 28,054,323 R972Q possibly damaging Het
Atp2a2 T C 5: 122,461,700 K543E probably benign Het
Atp8b5 G A 4: 43,271,269 V4I probably benign Het
Bcar3 A T 3: 122,523,230 N617Y probably benign Het
Blm A G 7: 80,513,115 S163P probably benign Het
Cbx3 A G 6: 51,478,530 D87G probably benign Het
Celsr1 A G 15: 86,033,392 S127P probably benign Het
Cndp1 A T 18: 84,619,541 M356K probably damaging Het
Cnn2 G A 10: 79,992,527 E113K probably damaging Het
Col17a1 T A 19: 47,668,105 R573* probably null Het
Cttnbp2 T A 6: 18,501,992 E49V probably damaging Het
Dynlrb2 T A 8: 116,514,957 V80E possibly damaging Het
Ehbp1 A G 11: 22,138,001 V386A probably benign Het
Elfn1 C T 5: 139,972,087 P282L probably benign Het
Fam69a T C 5: 107,909,684 D336G probably damaging Het
Fan1 G A 7: 64,353,638 T812I probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat1 G A 8: 45,044,152 V4225I probably benign Het
Frem1 A G 4: 82,914,835 C1873R probably benign Het
Fsd1l T C 4: 53,647,755 I66T probably benign Het
Gabrr1 C A 4: 33,146,970 D52E probably benign Het
Il18rap T C 1: 40,543,089 L390P probably damaging Het
Il27ra T A 8: 84,039,612 D181V probably benign Het
Irgq C A 7: 24,534,409 H558Q probably damaging Het
Itsn2 C T 12: 4,706,983 Q1358* probably null Het
Kmt2c C T 5: 25,302,849 G3197S probably damaging Het
Lrrk2 A G 15: 91,767,340 Y1733C probably damaging Het
Mapk7 G A 11: 61,490,453 A510V probably damaging Het
Mtch1 A T 17: 29,332,724 C385S probably benign Het
Nfib A G 4: 82,353,521 probably null Het
Nostrin C T 2: 69,185,507 T448M possibly damaging Het
Olfr1066 A G 2: 86,455,806 V155A probably benign Het
Olfr1255 T C 2: 89,816,536 L64P probably damaging Het
Olfr1441 T A 19: 12,423,145 Y279N probably damaging Het
Olfr533 T A 7: 140,466,798 V199D probably damaging Het
Olfr670 A G 7: 104,959,917 Y272H probably benign Het
Pcdha2 T C 18: 36,940,330 V338A probably damaging Het
Pcdhgc3 A G 18: 37,807,745 T400A probably benign Het
Piezo2 C T 18: 63,012,723 S2710N probably benign Het
Ppp4r1 T A 17: 65,831,020 Y591* probably null Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rab42 T C 4: 132,302,614 E99G possibly damaging Het
Rd3l A T 12: 111,979,482 W188R probably damaging Het
Sap30bp A G 11: 115,951,968 D89G probably benign Het
Sptbn4 T C 7: 27,366,689 T1985A probably benign Het
Tec T C 5: 72,773,880 Y247C probably damaging Het
Tek G A 4: 94,827,826 probably null Het
Tex14 T C 11: 87,514,430 S723P possibly damaging Het
Thumpd3 T A 6: 113,047,631 L62Q probably damaging Het
Tlr12 A T 4: 128,616,170 D762E probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Txndc16 T A 14: 45,165,388 I316F probably damaging Het
Vamp1 T C 6: 125,218,575 S2P unknown Het
Vmn1r211 T A 13: 22,851,916 M194L probably benign Het
Zfp874a T A 13: 67,442,257 Q436L probably damaging Het
Other mutations in Olfr1436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Olfr1436 APN 19 12298785 missense probably damaging 0.99
IGL02129:Olfr1436 APN 19 12298458 missense probably damaging 1.00
PIT4378001:Olfr1436 UTSW 19 12298712 missense probably damaging 1.00
R0727:Olfr1436 UTSW 19 12299094 missense probably benign 0.03
R1244:Olfr1436 UTSW 19 12298496 missense probably damaging 0.98
R1647:Olfr1436 UTSW 19 12298659 missense probably benign
R1648:Olfr1436 UTSW 19 12298659 missense probably benign
R1837:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R1899:Olfr1436 UTSW 19 12298343 missense probably damaging 1.00
R2031:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R2305:Olfr1436 UTSW 19 12299087 missense probably benign 0.01
R4624:Olfr1436 UTSW 19 12298983 missense probably benign
R4681:Olfr1436 UTSW 19 12299049 missense probably benign 0.05
R4790:Olfr1436 UTSW 19 12298941 missense possibly damaging 0.60
R4865:Olfr1436 UTSW 19 12298580 missense probably damaging 1.00
R4941:Olfr1436 UTSW 19 12298896 missense possibly damaging 0.95
R5138:Olfr1436 UTSW 19 12298776 missense possibly damaging 0.56
R5161:Olfr1436 UTSW 19 12298789 missense probably damaging 0.99
R5560:Olfr1436 UTSW 19 12298644 nonsense probably null
R5983:Olfr1436 UTSW 19 12299103 missense probably benign 0.00
R6736:Olfr1436 UTSW 19 12298572 nonsense probably null
R6882:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R6883:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R7500:Olfr1436 UTSW 19 12298677 missense probably damaging 0.98
R7529:Olfr1436 UTSW 19 12298722 missense probably damaging 1.00
R7565:Olfr1436 UTSW 19 12298848 missense probably benign 0.09
R7611:Olfr1436 UTSW 19 12298878 missense probably damaging 0.99
R7850:Olfr1436 UTSW 19 12298632 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCCTCAGACTATAAACCAAAGGG -3'
(R):5'- CTCAGGTGTTTGCCATGCTG -3'

Sequencing Primer
(F):5'- GGGTTCAACATAGTAATCAACACAG -3'
(R):5'- CACTTCTGTGGACCCAACG -3'
Posted On2019-10-07