Incidental Mutation 'R7465:Col17a1'
ID578737
Institutional Source Beutler Lab
Gene Symbol Col17a1
Ensembl Gene ENSMUSG00000025064
Gene Namecollagen, type XVII, alpha 1
SynonymsBP180, Bpag2, BPAg2, Bpag
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7465 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location47646344-47692094 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 47668105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 573 (R573*)
Ref Sequence ENSEMBL: ENSMUSP00000026045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000086923]
Predicted Effect probably null
Transcript: ENSMUST00000026045
AA Change: R573*
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064
AA Change: R573*

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086923
AA Change: R573*
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064
AA Change: R573*

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a A T 13: 30,381,981 D343V probably benign Het
Anks1 G A 17: 28,054,323 R972Q possibly damaging Het
Atp2a2 T C 5: 122,461,700 K543E probably benign Het
Atp8b5 G A 4: 43,271,269 V4I probably benign Het
Bcar3 A T 3: 122,523,230 N617Y probably benign Het
Blm A G 7: 80,513,115 S163P probably benign Het
Cbx3 A G 6: 51,478,530 D87G probably benign Het
Celsr1 A G 15: 86,033,392 S127P probably benign Het
Cndp1 A T 18: 84,619,541 M356K probably damaging Het
Cnn2 G A 10: 79,992,527 E113K probably damaging Het
Cttnbp2 T A 6: 18,501,992 E49V probably damaging Het
Dynlrb2 T A 8: 116,514,957 V80E possibly damaging Het
Ehbp1 A G 11: 22,138,001 V386A probably benign Het
Elfn1 C T 5: 139,972,087 P282L probably benign Het
Fam69a T C 5: 107,909,684 D336G probably damaging Het
Fan1 G A 7: 64,353,638 T812I probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat1 G A 8: 45,044,152 V4225I probably benign Het
Frem1 A G 4: 82,914,835 C1873R probably benign Het
Fsd1l T C 4: 53,647,755 I66T probably benign Het
Gabrr1 C A 4: 33,146,970 D52E probably benign Het
Il18rap T C 1: 40,543,089 L390P probably damaging Het
Il27ra T A 8: 84,039,612 D181V probably benign Het
Irgq C A 7: 24,534,409 H558Q probably damaging Het
Itsn2 C T 12: 4,706,983 Q1358* probably null Het
Kmt2c C T 5: 25,302,849 G3197S probably damaging Het
Lrrk2 A G 15: 91,767,340 Y1733C probably damaging Het
Mapk7 G A 11: 61,490,453 A510V probably damaging Het
Mtch1 A T 17: 29,332,724 C385S probably benign Het
Nfib A G 4: 82,353,521 probably null Het
Nostrin C T 2: 69,185,507 T448M possibly damaging Het
Olfr1066 A G 2: 86,455,806 V155A probably benign Het
Olfr1255 T C 2: 89,816,536 L64P probably damaging Het
Olfr1436 T C 19: 12,298,437 I232V probably benign Het
Olfr1441 T A 19: 12,423,145 Y279N probably damaging Het
Olfr533 T A 7: 140,466,798 V199D probably damaging Het
Olfr670 A G 7: 104,959,917 Y272H probably benign Het
Pcdha2 T C 18: 36,940,330 V338A probably damaging Het
Pcdhgc3 A G 18: 37,807,745 T400A probably benign Het
Piezo2 C T 18: 63,012,723 S2710N probably benign Het
Ppp4r1 T A 17: 65,831,020 Y591* probably null Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rab42 T C 4: 132,302,614 E99G possibly damaging Het
Rd3l A T 12: 111,979,482 W188R probably damaging Het
Sap30bp A G 11: 115,951,968 D89G probably benign Het
Smok2a A G 17: 13,226,055 K173R probably benign Het
Sptbn4 T C 7: 27,366,689 T1985A probably benign Het
Tec T C 5: 72,773,880 Y247C probably damaging Het
Tek G A 4: 94,827,826 probably null Het
Tex14 T C 11: 87,514,430 S723P possibly damaging Het
Thumpd3 T A 6: 113,047,631 L62Q probably damaging Het
Tlr12 A T 4: 128,616,170 D762E probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Txndc16 T A 14: 45,165,388 I316F probably damaging Het
Vamp1 T C 6: 125,218,575 S2P unknown Het
Vmn1r211 T A 13: 22,851,916 M194L probably benign Het
Zfp874a T A 13: 67,442,257 Q436L probably damaging Het
Other mutations in Col17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Col17a1 APN 19 47681403 missense probably damaging 1.00
IGL01620:Col17a1 APN 19 47668539 missense possibly damaging 0.81
IGL02149:Col17a1 APN 19 47668632 missense probably benign 0.01
IGL02176:Col17a1 APN 19 47651219 missense probably benign 0.02
IGL03352:Col17a1 APN 19 47681375 splice site probably null
IGL03409:Col17a1 APN 19 47666540 missense possibly damaging 0.79
scabby UTSW 19 47680408 nonsense probably null
IGL03050:Col17a1 UTSW 19 47648098 critical splice donor site probably null
PIT4480001:Col17a1 UTSW 19 47671374 missense probably benign 0.05
R0309:Col17a1 UTSW 19 47671362 splice site probably benign
R0316:Col17a1 UTSW 19 47685533 critical splice donor site probably null
R0330:Col17a1 UTSW 19 47670432 missense probably benign 0.27
R0391:Col17a1 UTSW 19 47663824 missense probably damaging 0.99
R0570:Col17a1 UTSW 19 47665878 missense possibly damaging 0.93
R0737:Col17a1 UTSW 19 47669433 missense possibly damaging 0.95
R1344:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1418:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1549:Col17a1 UTSW 19 47648910 unclassified probably benign
R1585:Col17a1 UTSW 19 47650837 missense probably benign 0.00
R1710:Col17a1 UTSW 19 47670931 missense probably damaging 1.00
R1712:Col17a1 UTSW 19 47649003 unclassified probably benign
R1800:Col17a1 UTSW 19 47650862 missense possibly damaging 0.72
R2007:Col17a1 UTSW 19 47667702 missense probably damaging 1.00
R2024:Col17a1 UTSW 19 47650746 missense probably benign 0.02
R2258:Col17a1 UTSW 19 47681377 critical splice donor site probably null
R2268:Col17a1 UTSW 19 47650111 missense probably benign 0.00
R3608:Col17a1 UTSW 19 47680405 missense probably benign 0.00
R4380:Col17a1 UTSW 19 47657090 missense possibly damaging 0.94
R4675:Col17a1 UTSW 19 47663058 critical splice acceptor site probably null
R4928:Col17a1 UTSW 19 47670458 splice site probably null
R5058:Col17a1 UTSW 19 47685550 nonsense probably null
R5407:Col17a1 UTSW 19 47666507 missense probably damaging 1.00
R5417:Col17a1 UTSW 19 47662390 missense probably damaging 1.00
R5572:Col17a1 UTSW 19 47650729 missense probably benign 0.44
R5889:Col17a1 UTSW 19 47649072 missense possibly damaging 0.93
R5988:Col17a1 UTSW 19 47654220 missense probably damaging 1.00
R6054:Col17a1 UTSW 19 47680420 missense probably damaging 1.00
R6345:Col17a1 UTSW 19 47653379 missense possibly damaging 0.93
R6432:Col17a1 UTSW 19 47680408 nonsense probably null
R6484:Col17a1 UTSW 19 47670429 missense possibly damaging 0.67
R6754:Col17a1 UTSW 19 47650721 splice site probably null
R7028:Col17a1 UTSW 19 47652183 missense probably damaging 0.96
R7565:Col17a1 UTSW 19 47671524 missense possibly damaging 0.77
R7662:Col17a1 UTSW 19 47681501 missense probably benign 0.04
R7726:Col17a1 UTSW 19 47655190 critical splice donor site probably null
Z1088:Col17a1 UTSW 19 47652178 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGAGTCAACTTCCAGCCTTCC -3'
(R):5'- TCACTGGTGGGAAACTGTG -3'

Sequencing Primer
(F):5'- TTCCAGCCTTCCGACAGACAG -3'
(R):5'- AACTGTGTCTAGGAGAGAATTGCTC -3'
Posted On2019-10-07