Incidental Mutation 'R7466:Manba'
ID 578752
Institutional Source Beutler Lab
Gene Symbol Manba
Ensembl Gene ENSMUSG00000028164
Gene Name mannosidase, beta A, lysosomal
Synonyms B930014J03Rik, Bmn, 2410030O07Rik
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 135191372-135277165 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 135248154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 348 (L348I)
Ref Sequence ENSEMBL: ENSMUSP00000029814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029814] [ENSMUST00000131610]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029814
AA Change: L348I

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: L348I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 42 211 6.5e-11 PFAM
Pfam:Glyco_hydro_2_C 340 595 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131610
SMART Domains Protein: ENSMUSP00000122148
Gene: ENSMUSG00000028164

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 22 163 1.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Cftr T C 6: 18,227,972 (GRCm39) M388T probably benign Het
Chrnb1 G A 11: 69,675,476 (GRCm39) H493Y probably damaging Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd2b A G 7: 109,124,553 (GRCm39) L1096P probably damaging Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Nsd2 G A 5: 34,039,491 (GRCm39) W834* probably null Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcb A T 7: 122,116,067 (GRCm39) N182I probably damaging Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc24a1 C G 9: 64,835,686 (GRCm39) E814Q unknown Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve26 C T 12: 79,334,581 (GRCm39) E146K probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Manba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Manba APN 3 135,260,541 (GRCm39) nonsense probably null
IGL01443:Manba APN 3 135,250,589 (GRCm39) missense probably damaging 1.00
IGL01796:Manba APN 3 135,248,150 (GRCm39) missense probably damaging 1.00
IGL02396:Manba APN 3 135,250,525 (GRCm39) missense probably damaging 1.00
IGL02471:Manba APN 3 135,212,769 (GRCm39) splice site probably benign
IGL02809:Manba APN 3 135,253,321 (GRCm39) missense probably damaging 1.00
IGL02861:Manba APN 3 135,276,024 (GRCm39) missense probably benign 0.03
IGL02934:Manba APN 3 135,250,510 (GRCm39) missense probably benign 0.00
IGL03130:Manba APN 3 135,256,920 (GRCm39) missense probably damaging 1.00
IGL03237:Manba APN 3 135,250,512 (GRCm39) missense probably damaging 1.00
IGL03342:Manba APN 3 135,223,748 (GRCm39) missense possibly damaging 0.51
R0551:Manba UTSW 3 135,223,734 (GRCm39) missense probably damaging 0.98
R1549:Manba UTSW 3 135,250,567 (GRCm39) missense probably damaging 1.00
R1752:Manba UTSW 3 135,212,706 (GRCm39) missense probably damaging 1.00
R1932:Manba UTSW 3 135,250,501 (GRCm39) missense probably benign 0.01
R1991:Manba UTSW 3 135,256,952 (GRCm39) missense probably benign 0.05
R3729:Manba UTSW 3 135,260,611 (GRCm39) missense probably benign 0.00
R3731:Manba UTSW 3 135,260,611 (GRCm39) missense probably benign 0.00
R3813:Manba UTSW 3 135,269,023 (GRCm39) missense possibly damaging 0.67
R4712:Manba UTSW 3 135,250,575 (GRCm39) missense probably damaging 1.00
R5001:Manba UTSW 3 135,273,391 (GRCm39) missense probably benign 0.00
R5481:Manba UTSW 3 135,230,317 (GRCm39) missense possibly damaging 0.86
R5889:Manba UTSW 3 135,230,359 (GRCm39) nonsense probably null
R6033:Manba UTSW 3 135,255,022 (GRCm39) missense probably benign 0.00
R6033:Manba UTSW 3 135,255,022 (GRCm39) missense probably benign 0.00
R6434:Manba UTSW 3 135,217,734 (GRCm39) splice site probably null
R6760:Manba UTSW 3 135,248,212 (GRCm39) missense probably damaging 0.98
R7164:Manba UTSW 3 135,248,149 (GRCm39) missense probably damaging 1.00
R7182:Manba UTSW 3 135,273,274 (GRCm39) missense probably benign 0.06
R7184:Manba UTSW 3 135,228,915 (GRCm39) missense possibly damaging 0.62
R7212:Manba UTSW 3 135,273,396 (GRCm39) missense probably benign
R7266:Manba UTSW 3 135,223,673 (GRCm39) missense probably damaging 1.00
R7271:Manba UTSW 3 135,248,137 (GRCm39) missense probably damaging 1.00
R7467:Manba UTSW 3 135,250,562 (GRCm39) missense probably damaging 1.00
R7542:Manba UTSW 3 135,272,354 (GRCm39) missense probably benign 0.10
R7546:Manba UTSW 3 135,276,007 (GRCm39) missense probably benign 0.01
R7726:Manba UTSW 3 135,223,770 (GRCm39) missense probably benign 0.14
R8475:Manba UTSW 3 135,217,573 (GRCm39) missense probably benign 0.13
R8768:Manba UTSW 3 135,256,995 (GRCm39) missense probably damaging 1.00
R8856:Manba UTSW 3 135,223,764 (GRCm39) missense probably damaging 0.98
R9140:Manba UTSW 3 135,191,490 (GRCm39) missense probably benign
R9449:Manba UTSW 3 135,255,079 (GRCm39) missense probably benign 0.01
Z1176:Manba UTSW 3 135,269,035 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATGTACATATGGTGTGTTTGTACA -3'
(R):5'- CTCCAGTCCTTCTGCTGGGA -3'

Sequencing Primer
(F):5'- GTTCTCGTGAGACAGAATCACTC -3'
(R):5'- CATACTCACCGATCGGAA -3'
Posted On 2019-10-07