Mutagenetix > Incidental Mutation

Incidental Mutation 'R7466:Manba'

578752

Institutional Source

Beutler Lab

Gene Symbol

Manba

Ensembl Gene

ENSMUSG00000028164

Gene Name

mannosidase, beta A, lysosomal

Synonyms

B930014J03Rik, Bmn, 2410030O07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R7466 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135485611-135571404 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 135542393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 348 (L348I)

Ref Sequence

ENSEMBL: ENSMUSP00000029814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029814] [ENSMUST00000131610]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000029814
AA Change: L348I

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: L348I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Glyco_hydro_2_N	42	211	6.5e-11	PFAM
Pfam:Glyco_hydro_2_C	340	595	3.8e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131610

SMART Domains

Protein: ENSMUSP00000122148
Gene: ENSMUSG00000028164

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Glyco_hydro_2_N	22	163	1.8e-10	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI182371	T	A	2: 35,088,741	K203*	probably null	Het
Akr1c13	T	C	13: 4,192,437		probably benign	Het
Amer3	A	G	1: 34,587,993	S438G	probably damaging	Het
Aqp9	T	A	9: 71,163,261		probably null	Het
Art4	G	T	6: 136,854,850	H98N	probably damaging	Het
Bdh1	T	C	16: 31,447,604	S70P	probably benign	Het
Ccdc61	A	C	7: 18,891,105	Y503D	probably damaging	Het
Cd163l1	T	C	7: 140,220,706		probably null	Het
Cd180	A	T	13: 102,704,995	N183I	probably damaging	Het
Cd200r2	C	T	16: 44,909,174	A64V	probably damaging	Het
Ceacam9	A	C	7: 16,723,855	K98Q	probably benign	Het
Cep44	AACGC	A	8: 56,540,983		probably null	Het
Cfap77	G	T	2: 28,955,613	D247E	probably benign	Het
Cftr	T	C	6: 18,227,973	M388T	probably benign	Het
Chrnb1	G	A	11: 69,784,650	H493Y	probably damaging	Het
Ckap2	A	C	8: 22,177,386	M153R	probably benign	Het
Cnot6l	A	G	5: 96,131,128	V77A	probably benign	Het
Col12a1	C	T	9: 79,655,407	E1798K	possibly damaging	Het
Cth	T	A	3: 157,924,885	D49V	probably benign	Het
Ctnnb1	T	C	9: 120,955,416	S425P	probably damaging	Het
Ctnnd1	T	C	2: 84,610,785	N690S	probably benign	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dennd4c	A	G	4: 86,774,331	D26G	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Eef2k	A	G	7: 120,903,484		probably null	Het
Ephb2	C	T	4: 136,659,065	R791H	probably damaging	Het
Erh	T	C	12: 80,640,983	Y22C	probably benign	Het
F5	C	T	1: 164,193,328	T1124I	possibly damaging	Het
Fam220a	T	A	5: 143,563,471	C213S	possibly damaging	Het
Fat2	G	T	11: 55,310,432	N605K	probably damaging	Het
Ganab	C	A	19: 8,914,569	S780*	probably null	Het
Gbgt1	C	T	2: 28,502,207	P67S	probably damaging	Het
Gm17190	G	T	13: 96,082,779	G208*	probably null	Het
Grhl2	A	G	15: 37,291,616	Y316C	probably damaging	Het
H2-T10	T	C	17: 36,120,849	T38A	probably benign	Het
Ins1	A	G	19: 52,264,420		probably benign	Het
Ippk	T	C	13: 49,432,467		probably null	Het
Klc4	T	A	17: 46,639,910	I258F	probably benign	Het
Mgam	A	G	6: 40,744,789	N347S	probably benign	Het
Myo18b	T	C	5: 112,723,892	T2108A	probably benign	Het
Naip5	A	T	13: 100,221,986	L914*	probably null	Het
Nsa2	C	T	13: 97,131,220	A242T	probably benign	Het
Nsd2	G	A	5: 33,882,147	W834*	probably null	Het
Olfr1134	T	C	2: 87,656,396	N175S	possibly damaging	Het
Olfr1419	T	A	19: 11,870,316	D300V	possibly damaging	Het
Olfr285	T	C	15: 98,313,380	M57V	probably damaging	Het
Olfr469	A	T	7: 107,822,922	C182*	probably null	Het
Pam	A	T	1: 97,842,247	D599E	probably damaging	Het
Phf20l1	A	G	15: 66,636,884	K864R	probably damaging	Het
Plcl2	A	G	17: 50,608,468	D835G	probably damaging	Het
Ppm1m	C	A	9: 106,196,157	A329S	probably damaging	Het
Prep	T	C	10: 45,150,438	V486A	probably benign	Het
Prkcb	A	T	7: 122,516,844	N182I	probably damaging	Het
Prkcz	A	G	4: 155,271,602	F355S	probably damaging	Het
Psg20	C	T	7: 18,684,467	S125N	probably benign	Het
Psmd12	A	G	11: 107,492,057	D234G	probably benign	Het
Pvrig	A	T	5: 138,342,008	M14L	probably benign	Het
Rabgap1l	C	T	1: 160,226,484		probably null	Het
Rfc1	A	T	5: 65,275,426	C764S	probably damaging	Het
Ryr3	T	C	2: 112,926,957	D351G	probably benign	Het
Serpinb9g	T	C	13: 33,495,167	F340S	probably benign	Het
Sirpb1c	C	A	3: 15,832,266	L315F	probably damaging	Het
Slc24a1	C	G	9: 64,928,404	E814Q	unknown	Het
Slc26a11	A	T	11: 119,374,502	Q355L	probably damaging	Het
Sp100	C	T	1: 85,707,239	L483F	possibly damaging	Het
St5	A	G	7: 109,525,346	L1096P	probably damaging	Het
Ston1	T	A	17: 88,635,901	M245K	probably benign	Het
Swap70	T	A	7: 110,274,772	D442E	probably benign	Het
Syne2	T	A	12: 76,046,186	V450D	possibly damaging	Het
Tbck	T	A	3: 132,752,563	N651K	probably damaging	Het
Timd4	A	T	11: 46,817,758	T204S	probably benign	Het
Tmem102	A	G	11: 69,804,885	L87P	probably damaging	Het
Tmem55a	T	A	4: 14,912,477	Y195*	probably null	Het
Tmprss11e	T	A	5: 86,709,480	T325S	probably benign	Het
Trpm1	G	A	7: 64,240,582	V978M	probably damaging	Het
Wdr12	A	T	1: 60,094,511	D19E	probably benign	Het
Wdr35	G	A	12: 9,005,773	V482I	probably benign	Het
Wdr63	T	C	3: 146,055,618	D661G	probably benign	Het
Zer1	T	C	2: 30,101,484		probably null	Het
Zfp503	T	C	14: 21,986,011	D279G	probably benign	Het
Zfp870	A	T	17: 32,883,762	C198S	possibly damaging	Het
Zfyve26	C	T	12: 79,287,807	E146K	probably benign	Het
Zkscan6	T	C	11: 65,828,531	V459A	probably damaging	Het

Other mutations in Manba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Manba	APN	3	135554780	nonsense	probably null
IGL01443:Manba	APN	3	135544828	missense	probably damaging	1.00
IGL01796:Manba	APN	3	135542389	missense	probably damaging	1.00
IGL02396:Manba	APN	3	135544764	missense	probably damaging	1.00
IGL02471:Manba	APN	3	135507008	splice site	probably benign
IGL02809:Manba	APN	3	135547560	missense	probably damaging	1.00
IGL02861:Manba	APN	3	135570263	missense	probably benign	0.03
IGL02934:Manba	APN	3	135544749	missense	probably benign	0.00
IGL03130:Manba	APN	3	135551159	missense	probably damaging	1.00
IGL03237:Manba	APN	3	135544751	missense	probably damaging	1.00
IGL03342:Manba	APN	3	135517987	missense	possibly damaging	0.51
R0551:Manba	UTSW	3	135517973	missense	probably damaging	0.98
R1549:Manba	UTSW	3	135544806	missense	probably damaging	1.00
R1752:Manba	UTSW	3	135506945	missense	probably damaging	1.00
R1932:Manba	UTSW	3	135544740	missense	probably benign	0.01
R1991:Manba	UTSW	3	135551191	missense	probably benign	0.05
R3729:Manba	UTSW	3	135554850	missense	probably benign	0.00
R3731:Manba	UTSW	3	135554850	missense	probably benign	0.00
R3813:Manba	UTSW	3	135563262	missense	possibly damaging	0.67
R4712:Manba	UTSW	3	135544814	missense	probably damaging	1.00
R5001:Manba	UTSW	3	135567630	missense	probably benign	0.00
R5481:Manba	UTSW	3	135524556	missense	possibly damaging	0.86
R5889:Manba	UTSW	3	135524598	nonsense	probably null
R6033:Manba	UTSW	3	135549261	missense	probably benign	0.00
R6033:Manba	UTSW	3	135549261	missense	probably benign	0.00
R6434:Manba	UTSW	3	135511973	splice site	probably null
R6760:Manba	UTSW	3	135542451	missense	probably damaging	0.98
R7164:Manba	UTSW	3	135542388	missense	probably damaging	1.00
R7182:Manba	UTSW	3	135567513	missense	probably benign	0.06
R7184:Manba	UTSW	3	135523154	missense	possibly damaging	0.62
R7212:Manba	UTSW	3	135567635	missense	probably benign
R7266:Manba	UTSW	3	135517912	missense	probably damaging	1.00
R7271:Manba	UTSW	3	135542376	missense	probably damaging	1.00
R7467:Manba	UTSW	3	135544801	missense	probably damaging	1.00
R7542:Manba	UTSW	3	135566593	missense	probably benign	0.10
R7546:Manba	UTSW	3	135570246	missense	probably benign	0.01
R7726:Manba	UTSW	3	135518009	missense	probably benign	0.14
R8475:Manba	UTSW	3	135511812	missense	probably benign	0.13
R8768:Manba	UTSW	3	135551234	missense	probably damaging	1.00
R8856:Manba	UTSW	3	135518003	missense	probably damaging	0.98
R9140:Manba	UTSW	3	135485729	missense	probably benign
R9449:Manba	UTSW	3	135549318	missense	probably benign	0.01
Z1176:Manba	UTSW	3	135563274	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTATGTACATATGGTGTGTTTGTACA -3'
(R):5'- CTCCAGTCCTTCTGCTGGGA -3'

Sequencing Primer
(F):5'- GTTCTCGTGAGACAGAATCACTC -3'
(R):5'- CATACTCACCGATCGGAA -3'

Posted On

2019-10-07