Incidental Mutation 'R7466:Nsd2'
ID 578759
Institutional Source Beutler Lab
Gene Symbol Nsd2
Ensembl Gene ENSMUSG00000057406
Gene Name nuclear receptor binding SET domain protein 2
Synonyms 9430010A17Rik, 5830445G22Rik, D030027O06Rik, D930023B08Rik, C130020C13Rik, Whsc1, Whsc1l
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.843) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 33978069-34055319 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 34039491 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 834 (W834*)
Ref Sequence ENSEMBL: ENSMUSP00000067205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845] [ENSMUST00000202525]
AlphaFold Q8BVE8
Predicted Effect probably null
Transcript: ENSMUST00000058096
AA Change: W833*
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: W833*

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066854
AA Change: W834*
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: W834*

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075812
AA Change: W834*
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: W834*

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114399
SMART Domains Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137191
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139845
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141416
SMART Domains Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
Pfam:PWWP 202 314 1.1e-25 PFAM
low complexity region 379 390 N/A INTRINSIC
HMG 434 504 4.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142080
SMART Domains Protein: ENSMUSP00000115251
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
Blast:SET 2 148 7e-47 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000202525
AA Change: W175*
SMART Domains Protein: ENSMUSP00000144255
Gene: ENSMUSG00000057406
AA Change: W175*

DomainStartEndE-ValueType
PHD 11 53 8.5e-9 SMART
RING 12 52 7.3e-2 SMART
PHD 58 105 4.4e-3 SMART
RING 59 104 2.6e-4 SMART
PHD 175 215 1.5e-12 SMART
low complexity region 248 259 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Cftr T C 6: 18,227,972 (GRCm39) M388T probably benign Het
Chrnb1 G A 11: 69,675,476 (GRCm39) H493Y probably damaging Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd2b A G 7: 109,124,553 (GRCm39) L1096P probably damaging Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Manba C A 3: 135,248,154 (GRCm39) L348I probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcb A T 7: 122,116,067 (GRCm39) N182I probably damaging Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc24a1 C G 9: 64,835,686 (GRCm39) E814Q unknown Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve26 C T 12: 79,334,581 (GRCm39) E146K probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Nsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nsd2 APN 5 34,013,077 (GRCm39) missense probably damaging 1.00
IGL00420:Nsd2 APN 5 34,040,347 (GRCm39) missense possibly damaging 0.82
IGL01343:Nsd2 APN 5 34,000,922 (GRCm39) missense probably damaging 1.00
IGL01403:Nsd2 APN 5 34,042,722 (GRCm39) splice site probably benign
IGL01446:Nsd2 APN 5 34,018,530 (GRCm39) splice site probably benign
IGL01571:Nsd2 APN 5 34,022,031 (GRCm39) missense probably benign 0.32
IGL01862:Nsd2 APN 5 34,001,080 (GRCm39) missense probably null 1.00
IGL02040:Nsd2 APN 5 34,024,915 (GRCm39) splice site probably benign
IGL02528:Nsd2 APN 5 34,036,395 (GRCm39) unclassified probably benign
IGL02553:Nsd2 APN 5 34,003,542 (GRCm39) missense probably damaging 1.00
IGL02799:Nsd2 APN 5 34,022,132 (GRCm39) splice site probably benign
IGL02932:Nsd2 APN 5 34,037,472 (GRCm39) missense probably damaging 1.00
Badminton UTSW 5 34,039,491 (GRCm39) nonsense probably null
Game UTSW 5 34,042,816 (GRCm39) missense probably damaging 1.00
Match UTSW 5 34,036,454 (GRCm39) missense probably damaging 1.00
Navratilova UTSW 5 34,042,834 (GRCm39) missense probably damaging 0.97
Racquet UTSW 5 34,040,189 (GRCm39) missense probably damaging 1.00
serve UTSW 5 34,036,455 (GRCm39) missense possibly damaging 0.95
Tennis UTSW 5 34,000,857 (GRCm39) missense probably damaging 1.00
R0136:Nsd2 UTSW 5 34,012,880 (GRCm39) missense possibly damaging 0.89
R0372:Nsd2 UTSW 5 34,048,895 (GRCm39) missense probably damaging 0.98
R0521:Nsd2 UTSW 5 34,000,682 (GRCm39) missense probably damaging 1.00
R0548:Nsd2 UTSW 5 34,050,882 (GRCm39) missense probably damaging 1.00
R0726:Nsd2 UTSW 5 34,018,372 (GRCm39) unclassified probably benign
R1018:Nsd2 UTSW 5 34,000,585 (GRCm39) missense probably damaging 1.00
R1638:Nsd2 UTSW 5 34,039,464 (GRCm39) missense possibly damaging 0.87
R1649:Nsd2 UTSW 5 34,011,984 (GRCm39) missense probably damaging 0.98
R1675:Nsd2 UTSW 5 34,018,493 (GRCm39) missense probably benign 0.04
R1900:Nsd2 UTSW 5 34,003,513 (GRCm39) missense probably benign
R2001:Nsd2 UTSW 5 34,000,746 (GRCm39) missense probably damaging 1.00
R2167:Nsd2 UTSW 5 34,040,263 (GRCm39) missense probably damaging 1.00
R2261:Nsd2 UTSW 5 34,042,871 (GRCm39) missense probably damaging 1.00
R2966:Nsd2 UTSW 5 34,003,466 (GRCm39) missense probably benign 0.01
R3931:Nsd2 UTSW 5 34,003,461 (GRCm39) missense probably benign 0.01
R4429:Nsd2 UTSW 5 34,000,546 (GRCm39) missense probably damaging 1.00
R4596:Nsd2 UTSW 5 34,040,262 (GRCm39) missense probably damaging 1.00
R4958:Nsd2 UTSW 5 34,049,366 (GRCm39) missense probably damaging 1.00
R5346:Nsd2 UTSW 5 34,036,480 (GRCm39) missense possibly damaging 0.94
R5957:Nsd2 UTSW 5 34,012,947 (GRCm39) missense probably damaging 1.00
R6054:Nsd2 UTSW 5 34,039,505 (GRCm39) missense probably damaging 1.00
R6124:Nsd2 UTSW 5 34,000,610 (GRCm39) missense probably benign 0.08
R6302:Nsd2 UTSW 5 34,024,921 (GRCm39) missense possibly damaging 0.93
R6390:Nsd2 UTSW 5 34,038,525 (GRCm39) missense probably damaging 1.00
R6496:Nsd2 UTSW 5 34,000,857 (GRCm39) missense probably damaging 1.00
R6828:Nsd2 UTSW 5 34,050,912 (GRCm39) missense probably damaging 0.98
R6925:Nsd2 UTSW 5 34,036,454 (GRCm39) missense probably damaging 1.00
R7148:Nsd2 UTSW 5 34,042,855 (GRCm39) missense possibly damaging 0.57
R7311:Nsd2 UTSW 5 34,049,380 (GRCm39) missense probably damaging 1.00
R7337:Nsd2 UTSW 5 34,042,816 (GRCm39) missense probably damaging 1.00
R7567:Nsd2 UTSW 5 34,003,570 (GRCm39) missense probably damaging 0.99
R7704:Nsd2 UTSW 5 34,028,811 (GRCm39) makesense probably null
R7822:Nsd2 UTSW 5 34,000,938 (GRCm39) missense probably damaging 0.97
R7939:Nsd2 UTSW 5 34,012,933 (GRCm39) missense probably benign 0.22
R8127:Nsd2 UTSW 5 34,042,834 (GRCm39) missense probably damaging 0.97
R8485:Nsd2 UTSW 5 34,040,189 (GRCm39) missense probably damaging 1.00
R8782:Nsd2 UTSW 5 34,000,485 (GRCm39) start codon destroyed probably benign
R8783:Nsd2 UTSW 5 34,036,455 (GRCm39) missense possibly damaging 0.95
R8845:Nsd2 UTSW 5 34,039,885 (GRCm39) missense probably damaging 1.00
R9034:Nsd2 UTSW 5 34,037,478 (GRCm39) missense possibly damaging 0.92
R9183:Nsd2 UTSW 5 34,028,796 (GRCm39) missense probably damaging 0.99
R9283:Nsd2 UTSW 5 34,001,058 (GRCm39) missense probably benign 0.34
R9438:Nsd2 UTSW 5 34,000,632 (GRCm39) missense probably damaging 0.99
R9486:Nsd2 UTSW 5 34,018,493 (GRCm39) missense probably benign 0.04
R9792:Nsd2 UTSW 5 34,003,489 (GRCm39) missense possibly damaging 0.89
R9793:Nsd2 UTSW 5 34,003,489 (GRCm39) missense possibly damaging 0.89
R9795:Nsd2 UTSW 5 34,003,489 (GRCm39) missense possibly damaging 0.89
X0020:Nsd2 UTSW 5 34,012,101 (GRCm39) missense probably damaging 1.00
Z1088:Nsd2 UTSW 5 34,013,082 (GRCm39) critical splice donor site probably null
Z1177:Nsd2 UTSW 5 34,012,864 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGAGTATTTGTGGTCCTCAGG -3'
(R):5'- TGTCCCTCAGCCTGTAACTG -3'

Sequencing Primer
(F):5'- ATTTGTGGTCCTCAGGGTATTATTTC -3'
(R):5'- CAGAAGCACAAGTGTCAGTATATC -3'
Posted On 2019-10-07