Incidental Mutation 'R7466:Cftr'
ID 578767
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Name cystic fibrosis transmembrane conductance regulator
Synonyms Abcc7
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.220) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 18170686-18322767 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18227972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 388 (M388T)
Ref Sequence ENSEMBL: ENSMUSP00000049228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]
AlphaFold P26361
PDB Structure mouse CFTR NBD1 with AMP.PNP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) apo [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ADP [X-RAY DIFFRACTION]
Phosphorylated Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP, I4122 space group [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508S mutant [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508R mutant [X-RAY DIFFRACTION]
The crystal structure of the NBD1 domain of the mouse CFTR protein, deltaF508 mutant [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000045706
AA Change: M388T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: M388T

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115405
AA Change: M388T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: M388T

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115406
AA Change: M358T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: M358T

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129452
AA Change: M388T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: M388T

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.9e-39 PFAM
Pfam:ABC_tran 441 528 5.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140407
AA Change: M388T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: M388T

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Chrnb1 G A 11: 69,675,476 (GRCm39) H493Y probably damaging Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd2b A G 7: 109,124,553 (GRCm39) L1096P probably damaging Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Manba C A 3: 135,248,154 (GRCm39) L348I probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Nsd2 G A 5: 34,039,491 (GRCm39) W834* probably null Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcb A T 7: 122,116,067 (GRCm39) N182I probably damaging Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc24a1 C G 9: 64,835,686 (GRCm39) E814Q unknown Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve26 C T 12: 79,334,581 (GRCm39) E146K probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18,268,429 (GRCm39) critical splice donor site probably null
IGL01082:Cftr APN 6 18,226,102 (GRCm39) missense probably damaging 0.97
IGL01113:Cftr APN 6 18,270,252 (GRCm39) missense probably damaging 1.00
IGL01383:Cftr APN 6 18,226,040 (GRCm39) missense probably benign 0.00
IGL01595:Cftr APN 6 18,198,238 (GRCm39) splice site probably benign
IGL01820:Cftr APN 6 18,226,138 (GRCm39) missense probably damaging 1.00
IGL02223:Cftr APN 6 18,221,481 (GRCm39) missense probably damaging 1.00
IGL02249:Cftr APN 6 18,277,870 (GRCm39) missense possibly damaging 0.58
IGL02439:Cftr APN 6 18,258,237 (GRCm39) nonsense probably null
IGL02537:Cftr APN 6 18,274,596 (GRCm39) missense probably benign 0.31
IGL03234:Cftr APN 6 18,225,987 (GRCm39) missense probably damaging 0.96
BB004:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
BB014:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
PIT4453001:Cftr UTSW 6 18,214,105 (GRCm39) missense probably damaging 0.99
PIT4520001:Cftr UTSW 6 18,277,842 (GRCm39) missense probably benign 0.01
R0114:Cftr UTSW 6 18,282,447 (GRCm39) missense probably damaging 1.00
R0329:Cftr UTSW 6 18,226,096 (GRCm39) missense probably null 1.00
R0330:Cftr UTSW 6 18,226,096 (GRCm39) missense probably null 1.00
R0331:Cftr UTSW 6 18,235,225 (GRCm39) missense possibly damaging 0.72
R0480:Cftr UTSW 6 18,274,517 (GRCm39) splice site probably benign
R0612:Cftr UTSW 6 18,198,125 (GRCm39) missense probably benign 0.01
R0633:Cftr UTSW 6 18,305,979 (GRCm39) missense probably damaging 0.99
R0830:Cftr UTSW 6 18,270,224 (GRCm39) missense probably benign 0.02
R1559:Cftr UTSW 6 18,225,936 (GRCm39) missense probably benign 0.01
R1629:Cftr UTSW 6 18,226,105 (GRCm39) missense probably damaging 1.00
R1636:Cftr UTSW 6 18,226,156 (GRCm39) missense probably damaging 0.99
R1860:Cftr UTSW 6 18,268,288 (GRCm39) missense probably benign 0.00
R2043:Cftr UTSW 6 18,320,934 (GRCm39) missense probably benign
R2211:Cftr UTSW 6 18,214,279 (GRCm39) missense probably null 0.13
R4737:Cftr UTSW 6 18,299,882 (GRCm39) missense probably benign 0.19
R4793:Cftr UTSW 6 18,226,087 (GRCm39) missense probably damaging 1.00
R4857:Cftr UTSW 6 18,320,974 (GRCm39) missense possibly damaging 0.92
R4984:Cftr UTSW 6 18,235,198 (GRCm39) missense possibly damaging 0.89
R4999:Cftr UTSW 6 18,221,613 (GRCm39) missense probably benign 0.17
R5045:Cftr UTSW 6 18,230,080 (GRCm39) missense probably benign 0.20
R5183:Cftr UTSW 6 18,299,832 (GRCm39) missense probably damaging 0.99
R5197:Cftr UTSW 6 18,255,413 (GRCm39) missense probably benign 0.00
R5288:Cftr UTSW 6 18,226,128 (GRCm39) nonsense probably null
R5337:Cftr UTSW 6 18,319,058 (GRCm39) missense probably damaging 1.00
R5549:Cftr UTSW 6 18,227,953 (GRCm39) missense probably benign 0.00
R5596:Cftr UTSW 6 18,268,095 (GRCm39) missense probably benign 0.00
R5651:Cftr UTSW 6 18,255,364 (GRCm39) splice site probably null
R5660:Cftr UTSW 6 18,313,686 (GRCm39) missense probably benign 0.22
R5941:Cftr UTSW 6 18,313,645 (GRCm39) missense probably damaging 1.00
R6221:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6222:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6229:Cftr UTSW 6 18,220,683 (GRCm39) missense probably damaging 1.00
R6256:Cftr UTSW 6 18,274,660 (GRCm39) missense probably damaging 0.96
R6257:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6412:Cftr UTSW 6 18,285,603 (GRCm39) missense probably damaging 0.97
R6459:Cftr UTSW 6 18,258,235 (GRCm39) missense probably damaging 1.00
R6558:Cftr UTSW 6 18,222,527 (GRCm39) missense probably damaging 1.00
R6724:Cftr UTSW 6 18,255,973 (GRCm39) nonsense probably null
R6787:Cftr UTSW 6 18,274,607 (GRCm39) nonsense probably null
R6861:Cftr UTSW 6 18,268,107 (GRCm39) missense probably benign 0.00
R6888:Cftr UTSW 6 18,313,729 (GRCm39) critical splice donor site probably null
R7084:Cftr UTSW 6 18,226,137 (GRCm39) missense probably benign 0.17
R7105:Cftr UTSW 6 18,318,971 (GRCm39) missense probably damaging 1.00
R7320:Cftr UTSW 6 18,319,012 (GRCm39) missense probably damaging 0.97
R7359:Cftr UTSW 6 18,221,623 (GRCm39) missense probably benign 0.00
R7502:Cftr UTSW 6 18,214,295 (GRCm39) missense probably damaging 1.00
R7748:Cftr UTSW 6 18,277,888 (GRCm39) critical splice donor site probably null
R7808:Cftr UTSW 6 18,204,204 (GRCm39) missense probably benign
R7817:Cftr UTSW 6 18,267,967 (GRCm39) missense probably damaging 0.97
R7927:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
R7968:Cftr UTSW 6 18,226,048 (GRCm39) missense probably benign 0.00
R7995:Cftr UTSW 6 18,214,155 (GRCm39) missense probably damaging 1.00
R8171:Cftr UTSW 6 18,258,287 (GRCm39) missense probably damaging 1.00
R8210:Cftr UTSW 6 18,220,696 (GRCm39) missense probably damaging 1.00
R8548:Cftr UTSW 6 18,273,698 (GRCm39) missense possibly damaging 0.87
R8712:Cftr UTSW 6 18,274,696 (GRCm39) missense probably damaging 0.99
R8737:Cftr UTSW 6 18,319,728 (GRCm39) missense probably damaging 1.00
R8926:Cftr UTSW 6 18,268,003 (GRCm39) missense possibly damaging 0.83
R8979:Cftr UTSW 6 18,227,947 (GRCm39) missense probably benign 0.10
R8996:Cftr UTSW 6 18,255,945 (GRCm39) nonsense probably null
R9087:Cftr UTSW 6 18,214,180 (GRCm39) missense possibly damaging 0.91
R9115:Cftr UTSW 6 18,235,310 (GRCm39) missense probably damaging 1.00
R9406:Cftr UTSW 6 18,299,866 (GRCm39) missense probably benign 0.00
R9689:Cftr UTSW 6 18,313,649 (GRCm39) missense probably damaging 0.99
R9700:Cftr UTSW 6 18,268,359 (GRCm39) missense probably damaging 1.00
R9747:Cftr UTSW 6 18,285,636 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGAGTCCTACTGCTTGGTACTTTAAC -3'
(R):5'- AGGATAGCCCTCCTTACATCCC -3'

Sequencing Primer
(F):5'- ACTGCTTGGTACTTTAACTTTAAGAC -3'
(R):5'- GATAGCCCTCCTTACATCCCTATGAG -3'
Posted On 2019-10-07