Incidental Mutation 'R7466:St5'
ID578775
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Namesuppression of tumorigenicity 5
Synonyms2610305K15Rik, 2010004M01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R7466 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109523911-109703605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109525346 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1096 (L1096P)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000143107] [ENSMUST00000156921] [ENSMUST00000168005]
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: L1096P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: L1096P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079282
AA Change: L1096P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: L1096P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084738
AA Change: L679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: L679P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143107
SMART Domains Protein: ENSMUSP00000123410
Gene: ENSMUSG00000046364

DomainStartEndE-ValueType
Pfam:Ribosomal_L18e 26 146 7.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156921
Predicted Effect probably damaging
Transcript: ENSMUST00000168005
AA Change: L679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: L679P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Meta Mutation Damage Score 0.9415 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 35,088,741 K203* probably null Het
Akr1c13 T C 13: 4,192,437 probably benign Het
Amer3 A G 1: 34,587,993 S438G probably damaging Het
Aqp9 T A 9: 71,163,261 probably null Het
Art4 G T 6: 136,854,850 H98N probably damaging Het
Bdh1 T C 16: 31,447,604 S70P probably benign Het
Ccdc61 A C 7: 18,891,105 Y503D probably damaging Het
Cd163l1 T C 7: 140,220,706 probably null Het
Cd180 A T 13: 102,704,995 N183I probably damaging Het
Cd200r2 C T 16: 44,909,174 A64V probably damaging Het
Ceacam9 A C 7: 16,723,855 K98Q probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Cfap77 G T 2: 28,955,613 D247E probably benign Het
Cftr T C 6: 18,227,973 M388T probably benign Het
Chrnb1 G A 11: 69,784,650 H493Y probably damaging Het
Ckap2 A C 8: 22,177,386 M153R probably benign Het
Cnot6l A G 5: 96,131,128 V77A probably benign Het
Col12a1 C T 9: 79,655,407 E1798K possibly damaging Het
Cth T A 3: 157,924,885 D49V probably benign Het
Ctnnb1 T C 9: 120,955,416 S425P probably damaging Het
Ctnnd1 T C 2: 84,610,785 N690S probably benign Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dennd4c A G 4: 86,774,331 D26G probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Eef2k A G 7: 120,903,484 probably null Het
Ephb2 C T 4: 136,659,065 R791H probably damaging Het
Erh T C 12: 80,640,983 Y22C probably benign Het
F5 C T 1: 164,193,328 T1124I possibly damaging Het
Fam220a T A 5: 143,563,471 C213S possibly damaging Het
Fat2 G T 11: 55,310,432 N605K probably damaging Het
Ganab C A 19: 8,914,569 S780* probably null Het
Gbgt1 C T 2: 28,502,207 P67S probably damaging Het
Gm17190 G T 13: 96,082,779 G208* probably null Het
Grhl2 A G 15: 37,291,616 Y316C probably damaging Het
H2-T10 T C 17: 36,120,849 T38A probably benign Het
Ins1 A G 19: 52,264,420 probably benign Het
Ippk T C 13: 49,432,467 probably null Het
Klc4 T A 17: 46,639,910 I258F probably benign Het
Manba C A 3: 135,542,393 L348I probably benign Het
Mgam A G 6: 40,744,789 N347S probably benign Het
Myo18b T C 5: 112,723,892 T2108A probably benign Het
Naip5 A T 13: 100,221,986 L914* probably null Het
Nsa2 C T 13: 97,131,220 A242T probably benign Het
Nsd2 G A 5: 33,882,147 W834* probably null Het
Olfr1134 T C 2: 87,656,396 N175S possibly damaging Het
Olfr1419 T A 19: 11,870,316 D300V possibly damaging Het
Olfr285 T C 15: 98,313,380 M57V probably damaging Het
Olfr469 A T 7: 107,822,922 C182* probably null Het
Pam A T 1: 97,842,247 D599E probably damaging Het
Phf20l1 A G 15: 66,636,884 K864R probably damaging Het
Plcl2 A G 17: 50,608,468 D835G probably damaging Het
Ppm1m C A 9: 106,196,157 A329S probably damaging Het
Prep T C 10: 45,150,438 V486A probably benign Het
Prkcb A T 7: 122,516,844 N182I probably damaging Het
Prkcz A G 4: 155,271,602 F355S probably damaging Het
Psg20 C T 7: 18,684,467 S125N probably benign Het
Psmd12 A G 11: 107,492,057 D234G probably benign Het
Pvrig A T 5: 138,342,008 M14L probably benign Het
Rabgap1l C T 1: 160,226,484 probably null Het
Rfc1 A T 5: 65,275,426 C764S probably damaging Het
Ryr3 T C 2: 112,926,957 D351G probably benign Het
Serpinb9g T C 13: 33,495,167 F340S probably benign Het
Sirpb1c C A 3: 15,832,266 L315F probably damaging Het
Slc24a1 C G 9: 64,928,404 E814Q unknown Het
Slc26a11 A T 11: 119,374,502 Q355L probably damaging Het
Sp100 C T 1: 85,707,239 L483F possibly damaging Het
Ston1 T A 17: 88,635,901 M245K probably benign Het
Swap70 T A 7: 110,274,772 D442E probably benign Het
Syne2 T A 12: 76,046,186 V450D possibly damaging Het
Tbck T A 3: 132,752,563 N651K probably damaging Het
Timd4 A T 11: 46,817,758 T204S probably benign Het
Tmem102 A G 11: 69,804,885 L87P probably damaging Het
Tmem55a T A 4: 14,912,477 Y195* probably null Het
Tmprss11e T A 5: 86,709,480 T325S probably benign Het
Trpm1 G A 7: 64,240,582 V978M probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Wdr35 G A 12: 9,005,773 V482I probably benign Het
Wdr63 T C 3: 146,055,618 D661G probably benign Het
Zer1 T C 2: 30,101,484 probably null Het
Zfp503 T C 14: 21,986,011 D279G probably benign Het
Zfp870 A T 17: 32,883,762 C198S possibly damaging Het
Zfyve26 C T 12: 79,287,807 E146K probably benign Het
Zkscan6 T C 11: 65,828,531 V459A probably damaging Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 splice site probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
Bucolic UTSW 7 109525548 nonsense probably null
Halcyon UTSW 7 109556793 nonsense probably null
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7644:St5 UTSW 7 109556793 nonsense probably null
R8354:St5 UTSW 7 109525548 nonsense probably null
R8745:St5 UTSW 7 109557072 missense probably benign 0.02
RF062:St5 UTSW 7 109556946 unclassified probably benign
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTCTATCATATTTGCTGG -3'
(R):5'- TGGCTTCATCCAAGACAGGG -3'

Sequencing Primer
(F):5'- CTGGCCTAGATTCACAGCATTTTAGG -3'
(R):5'- CTTCATCCAAGACAGGGAGCTAAG -3'
Posted On2019-10-07