Incidental Mutation 'R7466:Dennd2b'
ID 578775
Institutional Source Beutler Lab
Gene Symbol Dennd2b
Ensembl Gene ENSMUSG00000031024
Gene Name DENN domain containing 2B
Synonyms Denn2b, 2610305K15Rik, St5, 2010004M01Rik
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109123118-109302812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109124553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1096 (L1096P)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000143107] [ENSMUST00000156921] [ENSMUST00000168005]
AlphaFold Q924W7
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: L1096P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: L1096P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079282
AA Change: L1096P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: L1096P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084738
AA Change: L679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: L679P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143107
SMART Domains Protein: ENSMUSP00000123410
Gene: ENSMUSG00000046364

DomainStartEndE-ValueType
Pfam:Ribosomal_L18e 26 146 7.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156921
Predicted Effect probably damaging
Transcript: ENSMUST00000168005
AA Change: L679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: L679P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Meta Mutation Damage Score 0.9415 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Cftr T C 6: 18,227,972 (GRCm39) M388T probably benign Het
Chrnb1 G A 11: 69,675,476 (GRCm39) H493Y probably damaging Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Manba C A 3: 135,248,154 (GRCm39) L348I probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Nsd2 G A 5: 34,039,491 (GRCm39) W834* probably null Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcb A T 7: 122,116,067 (GRCm39) N182I probably damaging Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc24a1 C G 9: 64,835,686 (GRCm39) E814Q unknown Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve26 C T 12: 79,334,581 (GRCm39) E146K probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Dennd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dennd2b APN 7 109,126,915 (GRCm39) missense possibly damaging 0.71
IGL01132:Dennd2b APN 7 109,169,212 (GRCm39) splice site probably null
IGL01288:Dennd2b APN 7 109,139,029 (GRCm39) missense probably damaging 0.96
IGL01645:Dennd2b APN 7 109,126,841 (GRCm39) nonsense probably null
IGL01714:Dennd2b APN 7 109,169,269 (GRCm39) missense probably damaging 0.99
IGL02021:Dennd2b APN 7 109,156,579 (GRCm39) missense probably damaging 1.00
IGL02302:Dennd2b APN 7 109,124,538 (GRCm39) missense probably damaging 1.00
IGL02496:Dennd2b APN 7 109,155,442 (GRCm39) missense possibly damaging 0.83
IGL02795:Dennd2b APN 7 109,155,571 (GRCm39) missense probably damaging 1.00
Bucolic UTSW 7 109,124,755 (GRCm39) nonsense probably null
Halcyon UTSW 7 109,156,000 (GRCm39) nonsense probably null
FR4340:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
FR4737:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
PIT4466001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4469001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4472001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
R0024:Dennd2b UTSW 7 109,123,866 (GRCm39) missense probably damaging 1.00
R0124:Dennd2b UTSW 7 109,141,718 (GRCm39) missense possibly damaging 0.66
R0125:Dennd2b UTSW 7 109,155,545 (GRCm39) missense probably benign 0.19
R0365:Dennd2b UTSW 7 109,138,156 (GRCm39) missense probably damaging 1.00
R0491:Dennd2b UTSW 7 109,156,411 (GRCm39) missense probably benign 0.45
R0534:Dennd2b UTSW 7 109,140,635 (GRCm39) missense probably damaging 1.00
R0662:Dennd2b UTSW 7 109,156,633 (GRCm39) missense probably damaging 1.00
R0743:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R0772:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0774:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0787:Dennd2b UTSW 7 109,124,827 (GRCm39) missense possibly damaging 0.94
R0884:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R1518:Dennd2b UTSW 7 109,156,562 (GRCm39) missense probably damaging 1.00
R1908:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R1909:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R2232:Dennd2b UTSW 7 109,156,414 (GRCm39) missense probably benign
R2358:Dennd2b UTSW 7 109,155,653 (GRCm39) missense probably benign 0.01
R2847:Dennd2b UTSW 7 109,124,544 (GRCm39) missense probably damaging 1.00
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2873:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2874:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R4534:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4536:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4559:Dennd2b UTSW 7 109,124,785 (GRCm39) missense probably damaging 1.00
R4798:Dennd2b UTSW 7 109,156,240 (GRCm39) missense probably damaging 0.99
R4846:Dennd2b UTSW 7 109,156,043 (GRCm39) nonsense probably null
R5110:Dennd2b UTSW 7 109,141,697 (GRCm39) missense probably benign 0.02
R5181:Dennd2b UTSW 7 109,155,997 (GRCm39) missense probably benign
R5268:Dennd2b UTSW 7 109,156,519 (GRCm39) missense probably benign
R5403:Dennd2b UTSW 7 109,156,112 (GRCm39) missense probably damaging 1.00
R5836:Dennd2b UTSW 7 109,140,552 (GRCm39) missense possibly damaging 0.78
R5932:Dennd2b UTSW 7 109,169,223 (GRCm39) missense probably damaging 1.00
R5937:Dennd2b UTSW 7 109,156,478 (GRCm39) missense possibly damaging 0.86
R6180:Dennd2b UTSW 7 109,156,095 (GRCm39) missense probably benign 0.11
R6741:Dennd2b UTSW 7 109,144,304 (GRCm39) missense possibly damaging 0.95
R6781:Dennd2b UTSW 7 109,124,511 (GRCm39) missense possibly damaging 0.83
R7086:Dennd2b UTSW 7 109,124,781 (GRCm39) missense probably damaging 1.00
R7644:Dennd2b UTSW 7 109,156,000 (GRCm39) nonsense probably null
R8354:Dennd2b UTSW 7 109,124,755 (GRCm39) nonsense probably null
R8745:Dennd2b UTSW 7 109,156,279 (GRCm39) missense probably benign 0.02
R8859:Dennd2b UTSW 7 109,123,863 (GRCm39) missense probably damaging 1.00
R9016:Dennd2b UTSW 7 109,139,642 (GRCm39) missense possibly damaging 0.84
R9178:Dennd2b UTSW 7 109,156,291 (GRCm39) missense probably benign 0.31
R9361:Dennd2b UTSW 7 109,126,991 (GRCm39) missense probably damaging 1.00
R9564:Dennd2b UTSW 7 109,125,536 (GRCm39) missense probably damaging 1.00
R9595:Dennd2b UTSW 7 109,155,973 (GRCm39) missense probably damaging 0.96
RF062:Dennd2b UTSW 7 109,156,153 (GRCm39) unclassified probably benign
X0067:Dennd2b UTSW 7 109,155,447 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTCTATCATATTTGCTGG -3'
(R):5'- TGGCTTCATCCAAGACAGGG -3'

Sequencing Primer
(F):5'- CTGGCCTAGATTCACAGCATTTTAGG -3'
(R):5'- CTTCATCCAAGACAGGGAGCTAAG -3'
Posted On 2019-10-07