Incidental Mutation 'R7466:Prkcb'
ID 578777
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Name protein kinase C, beta
Synonyms Prkcb1, A130082F03Rik, Prkcb2, Pkcb, PKC-Beta
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 121888327-122233625 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122116067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 182 (N182I)
Ref Sequence ENSEMBL: ENSMUSP00000070019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
AlphaFold P68404
Predicted Effect probably damaging
Transcript: ENSMUST00000064921
AA Change: N182I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: N182I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064989
AA Change: N182I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: N182I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143692
AA Change: N182I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: N182I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Meta Mutation Damage Score 0.8909 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Cftr T C 6: 18,227,972 (GRCm39) M388T probably benign Het
Chrnb1 G A 11: 69,675,476 (GRCm39) H493Y probably damaging Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd2b A G 7: 109,124,553 (GRCm39) L1096P probably damaging Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Manba C A 3: 135,248,154 (GRCm39) L348I probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Nsd2 G A 5: 34,039,491 (GRCm39) W834* probably null Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc24a1 C G 9: 64,835,686 (GRCm39) E814Q unknown Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve26 C T 12: 79,334,581 (GRCm39) E146K probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122,194,228 (GRCm39) missense probably damaging 1.00
IGL02045:Prkcb APN 7 122,189,390 (GRCm39) missense probably damaging 1.00
IGL02273:Prkcb APN 7 122,226,990 (GRCm39) missense probably damaging 1.00
IGL02638:Prkcb APN 7 122,200,063 (GRCm39) splice site probably benign
IGL02962:Prkcb APN 7 122,024,270 (GRCm39) splice site probably null
IGL03013:Prkcb APN 7 122,226,905 (GRCm39) missense probably damaging 1.00
IGL03224:Prkcb APN 7 122,116,147 (GRCm39) nonsense probably null
Almonde UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
Baghdad UTSW 7 122,226,886 (GRCm39) missense probably benign 0.07
Mesopotamia UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
Mosul UTSW 7 122,116,067 (GRCm39) missense probably damaging 1.00
tigris UTSW 7 122,024,200 (GRCm39) missense probably damaging 1.00
Tikrit UTSW 7 122,226,916 (GRCm39) missense probably damaging 1.00
untied UTSW 7 122,181,662 (GRCm39) missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122,127,699 (GRCm39) missense probably damaging 0.99
R0078:Prkcb UTSW 7 122,189,393 (GRCm39) missense probably damaging 1.00
R0409:Prkcb UTSW 7 122,024,200 (GRCm39) missense probably damaging 1.00
R0660:Prkcb UTSW 7 122,024,182 (GRCm39) missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
R1462:Prkcb UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
R1480:Prkcb UTSW 7 122,193,865 (GRCm39) missense probably damaging 1.00
R1518:Prkcb UTSW 7 122,143,854 (GRCm39) critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122,226,916 (GRCm39) missense probably damaging 1.00
R1860:Prkcb UTSW 7 122,167,424 (GRCm39) missense probably damaging 1.00
R3110:Prkcb UTSW 7 122,116,079 (GRCm39) missense probably damaging 0.99
R3112:Prkcb UTSW 7 122,116,079 (GRCm39) missense probably damaging 0.99
R4583:Prkcb UTSW 7 122,056,447 (GRCm39) missense probably benign 0.32
R4847:Prkcb UTSW 7 122,167,372 (GRCm39) missense probably benign 0.35
R5220:Prkcb UTSW 7 121,888,678 (GRCm39) missense probably damaging 1.00
R5487:Prkcb UTSW 7 122,199,948 (GRCm39) nonsense probably null
R5599:Prkcb UTSW 7 122,181,701 (GRCm39) missense probably benign 0.17
R5946:Prkcb UTSW 7 122,143,926 (GRCm39) missense probably benign
R6257:Prkcb UTSW 7 122,167,386 (GRCm39) missense probably benign
R6590:Prkcb UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
R6618:Prkcb UTSW 7 122,226,886 (GRCm39) missense probably benign 0.07
R6690:Prkcb UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
R6763:Prkcb UTSW 7 122,193,887 (GRCm39) missense probably damaging 1.00
R7289:Prkcb UTSW 7 122,143,910 (GRCm39) missense probably benign 0.04
R7414:Prkcb UTSW 7 122,167,450 (GRCm39) missense possibly damaging 0.83
R7540:Prkcb UTSW 7 122,167,357 (GRCm39) missense probably damaging 0.99
R8283:Prkcb UTSW 7 122,199,948 (GRCm39) nonsense probably null
R9072:Prkcb UTSW 7 122,127,771 (GRCm39) missense probably benign 0.14
R9483:Prkcb UTSW 7 122,181,663 (GRCm39) missense probably damaging 0.99
R9670:Prkcb UTSW 7 122,233,070 (GRCm39) nonsense probably null
V7581:Prkcb UTSW 7 122,127,699 (GRCm39) missense probably damaging 0.99
X0061:Prkcb UTSW 7 122,056,529 (GRCm39) missense probably benign 0.03
Z1177:Prkcb UTSW 7 122,167,419 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCAATCCTGTCAGGTTGTC -3'
(R):5'- TCCTGGCTAACAATACTGGAAGG -3'

Sequencing Primer
(F):5'- GTCAGGTTGTCTCATTTACATGC -3'
(R):5'- GCCTCTGTCACACATGCTAGG -3'
Posted On 2019-10-07