Incidental Mutation 'R0630:Slc9c1'
ID 57878
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 038819-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R0630 (G1)
Quality Score 167
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 45363483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,766,104 (GRCm39) probably benign Het
4930562C15Rik T A 16: 4,668,803 (GRCm39) N731K possibly damaging Het
Adgra1 A T 7: 139,432,500 (GRCm39) K113* probably null Het
Adgrl2 T C 3: 148,544,880 (GRCm39) I659M probably damaging Het
Adm G T 7: 110,227,755 (GRCm39) R41L probably damaging Het
Aimp2 T C 5: 143,843,419 (GRCm39) E97G probably benign Het
Aox1 T C 1: 58,376,480 (GRCm39) probably benign Het
Arhgap20 G A 9: 51,760,684 (GRCm39) R809H probably damaging Het
Arsa T C 15: 89,358,207 (GRCm39) probably benign Het
Atg2a G T 19: 6,294,547 (GRCm39) A88S probably damaging Het
Atm G A 9: 53,442,922 (GRCm39) probably benign Het
Atp1a2 A T 1: 172,118,842 (GRCm39) I100N possibly damaging Het
Camta2 G C 11: 70,569,131 (GRCm39) L605V probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc60 A G 5: 116,274,440 (GRCm39) V388A possibly damaging Het
Cdk14 C T 5: 5,185,422 (GRCm39) probably benign Het
Cdyl2 C T 8: 117,350,774 (GRCm39) G119E probably benign Het
Celsr3 A G 9: 108,704,891 (GRCm39) N458S probably damaging Het
Chd3 A C 11: 69,238,021 (GRCm39) H1808Q probably damaging Het
Cntnap2 T C 6: 46,965,694 (GRCm39) V835A probably damaging Het
Col4a1 C A 8: 11,249,889 (GRCm39) probably benign Het
Cpsf1 A G 15: 76,486,171 (GRCm39) V357A probably damaging Het
Cryzl1 A G 16: 91,504,107 (GRCm39) probably benign Het
Cts8 T C 13: 61,401,256 (GRCm39) K90R possibly damaging Het
Cux1 A G 5: 136,315,689 (GRCm39) V1117A probably damaging Het
Dbx1 T C 7: 49,282,444 (GRCm39) T254A probably damaging Het
Dgki C A 6: 36,977,133 (GRCm39) C659F probably damaging Het
Dnajc1 T G 2: 18,236,612 (GRCm39) D332A probably damaging Het
Dock8 C A 19: 25,038,524 (GRCm39) T70K probably benign Het
Dsc1 T A 18: 20,218,919 (GRCm39) T828S probably damaging Het
Dst T G 1: 34,232,531 (GRCm39) V3510G probably benign Het
Dst T C 1: 34,238,554 (GRCm39) V1738A probably damaging Het
Ehmt2 A G 17: 35,118,818 (GRCm39) T167A probably benign Het
Eri2 A T 7: 119,385,640 (GRCm39) V287E probably benign Het
Fat4 T A 3: 39,054,321 (GRCm39) L4121H probably damaging Het
Fbn1 T A 2: 125,236,690 (GRCm39) D330V possibly damaging Het
Fign A G 2: 63,810,485 (GRCm39) Y262H possibly damaging Het
Fnd3c2 C T X: 105,282,763 (GRCm39) M593I probably benign Het
Fndc7 T A 3: 108,783,931 (GRCm39) E226V probably damaging Het
Gad2 A T 2: 22,580,348 (GRCm39) Q583L probably benign Het
Gcn1 G A 5: 115,719,148 (GRCm39) A334T probably benign Het
Ggt1 A G 10: 75,421,336 (GRCm39) probably null Het
Gli2 C T 1: 118,769,648 (GRCm39) G635R possibly damaging Het
Gm10253 T C 3: 88,646,420 (GRCm39) E93G unknown Het
Gm10428 A G 11: 62,644,256 (GRCm39) probably benign Het
Gm7104 T C 12: 88,252,479 (GRCm39) noncoding transcript Het
Gm8258 T G 5: 104,924,385 (GRCm39) noncoding transcript Het
Gpr107 A G 2: 31,104,309 (GRCm39) N538S possibly damaging Het
Hars1 T C 18: 36,904,442 (GRCm39) E190G probably damaging Het
Hoxc10 C T 15: 102,875,917 (GRCm39) P209S probably benign Het
Ighg3 T C 12: 113,323,714 (GRCm39) probably benign Het
Igsf10 C A 3: 59,233,483 (GRCm39) W1750L probably damaging Het
Igsf5 C A 16: 96,174,023 (GRCm39) probably benign Het
Itga10 T C 3: 96,563,615 (GRCm39) probably benign Het
Ldhd T C 8: 112,353,934 (GRCm39) K422R probably benign Het
Masp1 T C 16: 23,271,169 (GRCm39) K693R probably benign Het
Mb21d2 G A 16: 28,748,324 (GRCm39) A31V probably benign Het
Mbd1 T A 18: 74,409,798 (GRCm39) probably benign Het
Mdm4 G A 1: 132,919,491 (GRCm39) T459I possibly damaging Het
Megf10 A T 18: 57,421,067 (GRCm39) I902F probably benign Het
Mta3 A G 17: 84,022,056 (GRCm39) N37S probably damaging Het
Mterf3 T A 13: 67,060,372 (GRCm39) Y372F probably damaging Het
Nbeal2 A G 9: 110,465,102 (GRCm39) probably benign Het
Nbr1 T C 11: 101,457,913 (GRCm39) probably benign Het
Ndst3 A G 3: 123,355,720 (GRCm39) M103T probably damaging Het
Notch3 C A 17: 32,366,446 (GRCm39) probably benign Het
Npr2 A T 4: 43,641,219 (GRCm39) E415V probably benign Het
Or2n1c A G 17: 38,519,304 (GRCm39) H56R probably damaging Het
Or4k40 T C 2: 111,251,191 (GRCm39) Y35C probably damaging Het
Or52h9 G C 7: 104,202,998 (GRCm39) V291L probably benign Het
Or5be3 A T 2: 86,863,653 (GRCm39) M304K probably benign Het
Or8b50 T A 9: 38,518,192 (GRCm39) F144I probably benign Het
Pappa2 T A 1: 158,660,343 (GRCm39) D1246V probably benign Het
Pcdhgc5 A T 18: 37,954,931 (GRCm39) D735V probably benign Het
Pik3ca A G 3: 32,504,176 (GRCm39) Y622C possibly damaging Het
Plppr2 A G 9: 21,859,197 (GRCm39) D438G probably benign Het
Ppfibp2 A T 7: 107,337,806 (GRCm39) probably null Het
Prdm15 A T 16: 97,638,907 (GRCm39) L77Q probably null Het
Prdm8 T C 5: 98,332,380 (GRCm39) S94P probably damaging Het
Prkdc A T 16: 15,628,665 (GRCm39) Q3470L probably damaging Het
Prl3c1 T C 13: 27,384,674 (GRCm39) probably benign Het
Ptchd4 A T 17: 42,688,076 (GRCm39) H206L probably benign Het
Rack1 G A 11: 48,694,804 (GRCm39) probably benign Het
Rere T C 4: 150,703,545 (GRCm39) L1509P probably damaging Het
Rgma T A 7: 73,067,366 (GRCm39) L301Q probably damaging Het
Rgs6 T A 12: 83,094,324 (GRCm39) probably benign Het
Rictor C A 15: 6,823,973 (GRCm39) R1613S probably damaging Het
Ripk1 T G 13: 34,211,764 (GRCm39) F358C probably damaging Het
Robo2 T C 16: 73,713,093 (GRCm39) D1217G probably benign Het
Shc2 A T 10: 79,461,975 (GRCm39) W357R probably null Het
Slc25a45 T C 19: 5,930,556 (GRCm39) L81P probably damaging Het
Spats2 T C 15: 99,083,909 (GRCm39) probably null Het
Stac3 A T 10: 127,343,632 (GRCm39) E258V probably damaging Het
Thada A G 17: 84,536,603 (GRCm39) S1648P probably damaging Het
Tmem168 T C 6: 13,583,064 (GRCm39) T222A probably benign Het
Tmtc4 T C 14: 123,163,502 (GRCm39) probably benign Het
Trappc14 A G 5: 138,260,551 (GRCm39) S292P probably damaging Het
Trim38 T G 13: 23,975,115 (GRCm39) Y351* probably null Het
Trip12 T C 1: 84,771,636 (GRCm39) R213G possibly damaging Het
Vav3 C T 3: 109,331,328 (GRCm39) R76W probably damaging Het
Vmn1r63 G T 7: 5,806,263 (GRCm39) P123H probably damaging Het
Wdr5 A G 2: 27,410,619 (GRCm39) N130S probably benign Het
Wnk4 C A 11: 101,156,212 (GRCm39) R27S probably damaging Het
Ykt6 G A 11: 5,909,323 (GRCm39) S44N probably benign Het
Ythdc1 T A 5: 86,957,207 (GRCm39) probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAAATCCGCTATATGACCTTTACTCCC -3'
(R):5'- TGAAAGCAGAACCATTACCTGCCAA -3'

Sequencing Primer
(F):5'- ATCCTCTCTCTGAGAAGGGC -3'
(R):5'- CCTGCCAAAATAACTTTTGAAGC -3'
Posted On 2013-07-11