Incidental Mutation 'R7466:Slc24a1'
ID 578781
Institutional Source Beutler Lab
Gene Symbol Slc24a1
Ensembl Gene ENSMUSG00000034452
Gene Name solute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Synonyms
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 64830143-64858889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 64835686 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 814 (E814Q)
Ref Sequence ENSEMBL: ENSMUSP00000035616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037798]
AlphaFold Q91WD8
Predicted Effect unknown
Transcript: ENSMUST00000037798
AA Change: E814Q
SMART Domains Protein: ENSMUSP00000035616
Gene: ENSMUSG00000034452
AA Change: E814Q

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Na_Ca_ex 425 569 1.7e-28 PFAM
low complexity region 683 699 N/A INTRINSIC
coiled coil region 747 776 N/A INTRINSIC
coiled coil region 818 847 N/A INTRINSIC
coiled coil region 898 928 N/A INTRINSIC
transmembrane domain 939 956 N/A INTRINSIC
Pfam:Na_Ca_ex 967 1118 1.7e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. The encoded protein plays an important role in sodium/calcium exchange in retinal rod and cone photoreceptors by mediating the extrusion of one calcium ion and one potassium ion in exchange for four sodium ions. Mutations in this gene may play a role in congenital stationary night blindness. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele display slow progressive retinal degeneration and develop stationary night blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Cftr T C 6: 18,227,972 (GRCm39) M388T probably benign Het
Chrnb1 G A 11: 69,675,476 (GRCm39) H493Y probably damaging Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd2b A G 7: 109,124,553 (GRCm39) L1096P probably damaging Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Manba C A 3: 135,248,154 (GRCm39) L348I probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Nsd2 G A 5: 34,039,491 (GRCm39) W834* probably null Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcb A T 7: 122,116,067 (GRCm39) N182I probably damaging Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve26 C T 12: 79,334,581 (GRCm39) E146K probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Slc24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Slc24a1 APN 9 64,835,301 (GRCm39) missense probably damaging 0.99
IGL01602:Slc24a1 APN 9 64,833,463 (GRCm39) missense probably damaging 1.00
IGL03111:Slc24a1 APN 9 64,833,608 (GRCm39) missense probably damaging 0.98
R0092:Slc24a1 UTSW 9 64,856,034 (GRCm39) missense unknown
R0708:Slc24a1 UTSW 9 64,855,172 (GRCm39) missense unknown
R0827:Slc24a1 UTSW 9 64,835,472 (GRCm39) missense probably benign 0.03
R1294:Slc24a1 UTSW 9 64,843,295 (GRCm39) missense unknown
R1613:Slc24a1 UTSW 9 64,855,978 (GRCm39) missense unknown
R2858:Slc24a1 UTSW 9 64,856,614 (GRCm39) missense unknown
R3779:Slc24a1 UTSW 9 64,855,579 (GRCm39) missense unknown
R3899:Slc24a1 UTSW 9 64,835,426 (GRCm39) missense probably damaging 0.99
R3900:Slc24a1 UTSW 9 64,835,426 (GRCm39) missense probably damaging 0.99
R4409:Slc24a1 UTSW 9 64,855,506 (GRCm39) missense probably benign 0.39
R4732:Slc24a1 UTSW 9 64,856,836 (GRCm39) missense probably benign 0.23
R4733:Slc24a1 UTSW 9 64,856,836 (GRCm39) missense probably benign 0.23
R4745:Slc24a1 UTSW 9 64,856,758 (GRCm39) missense unknown
R4915:Slc24a1 UTSW 9 64,855,213 (GRCm39) missense unknown
R5371:Slc24a1 UTSW 9 64,856,550 (GRCm39) missense unknown
R5448:Slc24a1 UTSW 9 64,855,609 (GRCm39) missense probably benign 0.39
R5540:Slc24a1 UTSW 9 64,855,863 (GRCm39) missense unknown
R5863:Slc24a1 UTSW 9 64,835,824 (GRCm39) missense unknown
R6161:Slc24a1 UTSW 9 64,844,545 (GRCm39) missense unknown
R6810:Slc24a1 UTSW 9 64,855,605 (GRCm39) missense probably benign 0.39
R7215:Slc24a1 UTSW 9 64,835,785 (GRCm39) missense unknown
R7380:Slc24a1 UTSW 9 64,855,815 (GRCm39) missense unknown
R7453:Slc24a1 UTSW 9 64,856,583 (GRCm39) missense unknown
R7488:Slc24a1 UTSW 9 64,831,764 (GRCm39) missense probably benign 0.41
R7672:Slc24a1 UTSW 9 64,855,209 (GRCm39) missense unknown
R7939:Slc24a1 UTSW 9 64,835,648 (GRCm39) missense probably benign 0.33
R7984:Slc24a1 UTSW 9 64,856,811 (GRCm39) nonsense probably null
R8097:Slc24a1 UTSW 9 64,831,734 (GRCm39) missense probably damaging 0.97
R8724:Slc24a1 UTSW 9 64,855,453 (GRCm39) missense probably benign 0.39
R8812:Slc24a1 UTSW 9 64,835,985 (GRCm39) missense unknown
R9122:Slc24a1 UTSW 9 64,834,478 (GRCm39) missense probably benign 0.03
R9252:Slc24a1 UTSW 9 64,835,394 (GRCm39) missense probably damaging 0.99
X0063:Slc24a1 UTSW 9 64,856,425 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGTGGCCTCACATTGATC -3'
(R):5'- ATGTGGATGAGGCTGAACGC -3'

Sequencing Primer
(F):5'- GGTGGCCTCACATTGATCTTCAG -3'
(R):5'- TGAGGCTGAACGCAGAGG -3'
Posted On 2019-10-07