Incidental Mutation 'R7466:Ctnnb1'
ID578785
Institutional Source Beutler Lab
Gene Symbol Ctnnb1
Ensembl Gene ENSMUSG00000006932
Gene Namecatenin (cadherin associated protein), beta 1
Synonymsbeta-catenin, Catnb, beta catenin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7466 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location120929216-120960507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120955416 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 425 (S425P)
Ref Sequence ENSEMBL: ENSMUSP00000007130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007130] [ENSMUST00000130466] [ENSMUST00000130845] [ENSMUST00000145093] [ENSMUST00000154356] [ENSMUST00000163844] [ENSMUST00000178812]
PDB Structure CRYSTAL STRUCTURE OF A CHIMERA OF BETA-CATENIN AND ALPHA-CATENIN [X-RAY DIFFRACTION]
BETA-CATENIN/PHOSPHORYLATED E-CADHERIN COMPLEX [X-RAY DIFFRACTION]
BETA-CATENIN/E-CADHERIN COMPLEX [X-RAY DIFFRACTION]
The Structure of a beta-Catenin Binding Repeat from Adenomatous Polyposis Coli (APC) in Complex with beta-Catenin [X-RAY DIFFRACTION]
Beta-catenin armadillo repeat domain bound to ICAT [X-RAY DIFFRACTION]
THE CRYSTAL STRUCTURE OF BETA-CATENIN ARMADILLO REPEAT COMPLEXED WITH A PHOSPHORYLATED APC 20MER REPEAT. [X-RAY DIFFRACTION]
THE ARMADILLO REPEAT REGION FROM MURINE BETA-CATENIN [X-RAY DIFFRACTION]
THE ARMADILLO REPEAT REGION FROM MURINE BETA-CATENIN [X-RAY DIFFRACTION]
Structure of beta-catenin with Lef-1 [X-RAY DIFFRACTION]
Structure of beta-catenin with phosphorylated Lef-1 [X-RAY DIFFRACTION]
>> 6 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000007130
AA Change: S425P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007130
Gene: ENSMUSG00000006932
AA Change: S425P

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130466
Predicted Effect probably benign
Transcript: ENSMUST00000130845
SMART Domains Protein: ENSMUSP00000116365
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 80 2e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133689
SMART Domains Protein: ENSMUSP00000128564
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
Blast:ARM 2 41 2e-20 BLAST
Pfam:Arm 42 82 4.4e-9 PFAM
Blast:ARM 83 123 9e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145093
SMART Domains Protein: ENSMUSP00000120132
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 174 1e-113 PDB
SCOP:d1gw5a_ 90 172 5e-8 SMART
Blast:ARM 141 174 4e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154356
AA Change: S425P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125763
Gene: ENSMUSG00000006932
AA Change: S425P

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 562 3e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163844
SMART Domains Protein: ENSMUSP00000126905
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 72 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169931
SMART Domains Protein: ENSMUSP00000128858
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
ARM 2 36 3.8e1 SMART
ARM 41 82 7.34e-3 SMART
ARM 83 144 1.92e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170729
SMART Domains Protein: ENSMUSP00000130471
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
Blast:ARM 2 35 4e-15 BLAST
PDB:3SLA|E 2 87 1e-57 PDB
SCOP:d1jdha_ 2 89 2e-12 SMART
Blast:ARM 36 78 2e-23 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178812
AA Change: S425P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136294
Gene: ENSMUSG00000006932
AA Change: S425P

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Meta Mutation Damage Score 0.9284 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: This gene encodes not only an important cytoplasmic component of the classical cadherin adhesion complex that forms the adherens junction in epithelia and mediates cell-cell adhesion in many other tissues but also a key signaling molecule in the canonical Wnt signaling pathway that controls cell growth and differentiation during both normal development and tumorigenesis. The gene product contains a central armadillo-repeat containing domain through which it binds the cytoplasmic tail of classical cadherins; meanwhile, it also binds alpha-catenin, which further links the cadherin complex to the actin cytoskeleton either directly or indirectly. Beta-catenin is therefore necessary for the adhesive function of classical cadherins. Another key function of this protein is to mediate the canonical Wnt signaling pathway and regulate gene transcription. Without Wnt signal, cytoplasmic beta-catenin that is not associated with the cadherin complex is quickly phosphorylated at the N-terminal Ser/Thr residues by the so called degradation complex containing axin, adenomatous polyposis coli (APC), casein kinase I, and GSK3B, then ubiquitylated by beta-TrCP, and degraded by the proteasome. However, in the presence of Wnt signal, the degradation complex is disrupted and the stabilized cytoplasmic beta-catenin translocates into the nucleus, where it binds various transcription factors and, together with these factors, regulates the transcription of many downstream genes. Mutations of this gene have been linked with various types of tumors. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null embryos show anterior-posterior axis formation anomalies, but develop to E7. Multiple conditional mutations have shown defects in distinct stem cell types that result in proliferation defects, such as intestinal polyps, brain and spinal cord size anomalies, etc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 35,088,741 K203* probably null Het
Akr1c13 T C 13: 4,192,437 probably benign Het
Amer3 A G 1: 34,587,993 S438G probably damaging Het
Aqp9 T A 9: 71,163,261 probably null Het
Art4 G T 6: 136,854,850 H98N probably damaging Het
Bdh1 T C 16: 31,447,604 S70P probably benign Het
Ccdc61 A C 7: 18,891,105 Y503D probably damaging Het
Cd163l1 T C 7: 140,220,706 probably null Het
Cd180 A T 13: 102,704,995 N183I probably damaging Het
Cd200r2 C T 16: 44,909,174 A64V probably damaging Het
Ceacam9 A C 7: 16,723,855 K98Q probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Cfap77 G T 2: 28,955,613 D247E probably benign Het
Cftr T C 6: 18,227,973 M388T probably benign Het
Chrnb1 G A 11: 69,784,650 H493Y probably damaging Het
Ckap2 A C 8: 22,177,386 M153R probably benign Het
Cnot6l A G 5: 96,131,128 V77A probably benign Het
Col12a1 C T 9: 79,655,407 E1798K possibly damaging Het
Cth T A 3: 157,924,885 D49V probably benign Het
Ctnnd1 T C 2: 84,610,785 N690S probably benign Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dennd4c A G 4: 86,774,331 D26G probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Eef2k A G 7: 120,903,484 probably null Het
Ephb2 C T 4: 136,659,065 R791H probably damaging Het
Erh T C 12: 80,640,983 Y22C probably benign Het
F5 C T 1: 164,193,328 T1124I possibly damaging Het
Fam220a T A 5: 143,563,471 C213S possibly damaging Het
Fat2 G T 11: 55,310,432 N605K probably damaging Het
Ganab C A 19: 8,914,569 S780* probably null Het
Gbgt1 C T 2: 28,502,207 P67S probably damaging Het
Gm17190 G T 13: 96,082,779 G208* probably null Het
Grhl2 A G 15: 37,291,616 Y316C probably damaging Het
H2-T10 T C 17: 36,120,849 T38A probably benign Het
Ins1 A G 19: 52,264,420 probably benign Het
Ippk T C 13: 49,432,467 probably null Het
Klc4 T A 17: 46,639,910 I258F probably benign Het
Manba C A 3: 135,542,393 L348I probably benign Het
Mgam A G 6: 40,744,789 N347S probably benign Het
Myo18b T C 5: 112,723,892 T2108A probably benign Het
Naip5 A T 13: 100,221,986 L914* probably null Het
Nsa2 C T 13: 97,131,220 A242T probably benign Het
Nsd2 G A 5: 33,882,147 W834* probably null Het
Olfr1134 T C 2: 87,656,396 N175S possibly damaging Het
Olfr1419 T A 19: 11,870,316 D300V possibly damaging Het
Olfr285 T C 15: 98,313,380 M57V probably damaging Het
Olfr469 A T 7: 107,822,922 C182* probably null Het
Pam A T 1: 97,842,247 D599E probably damaging Het
Phf20l1 A G 15: 66,636,884 K864R probably damaging Het
Plcl2 A G 17: 50,608,468 D835G probably damaging Het
Ppm1m C A 9: 106,196,157 A329S probably damaging Het
Prep T C 10: 45,150,438 V486A probably benign Het
Prkcb A T 7: 122,516,844 N182I probably damaging Het
Prkcz A G 4: 155,271,602 F355S probably damaging Het
Psg20 C T 7: 18,684,467 S125N probably benign Het
Psmd12 A G 11: 107,492,057 D234G probably benign Het
Pvrig A T 5: 138,342,008 M14L probably benign Het
Rabgap1l C T 1: 160,226,484 probably null Het
Rfc1 A T 5: 65,275,426 C764S probably damaging Het
Ryr3 T C 2: 112,926,957 D351G probably benign Het
Serpinb9g T C 13: 33,495,167 F340S probably benign Het
Sirpb1c C A 3: 15,832,266 L315F probably damaging Het
Slc24a1 C G 9: 64,928,404 E814Q unknown Het
Slc26a11 A T 11: 119,374,502 Q355L probably damaging Het
Sp100 C T 1: 85,707,239 L483F possibly damaging Het
St5 A G 7: 109,525,346 L1096P probably damaging Het
Ston1 T A 17: 88,635,901 M245K probably benign Het
Swap70 T A 7: 110,274,772 D442E probably benign Het
Syne2 T A 12: 76,046,186 V450D possibly damaging Het
Tbck T A 3: 132,752,563 N651K probably damaging Het
Timd4 A T 11: 46,817,758 T204S probably benign Het
Tmem102 A G 11: 69,804,885 L87P probably damaging Het
Tmem55a T A 4: 14,912,477 Y195* probably null Het
Tmprss11e T A 5: 86,709,480 T325S probably benign Het
Trpm1 G A 7: 64,240,582 V978M probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Wdr35 G A 12: 9,005,773 V482I probably benign Het
Wdr63 T C 3: 146,055,618 D661G probably benign Het
Zer1 T C 2: 30,101,484 probably null Het
Zfp503 T C 14: 21,986,011 D279G probably benign Het
Zfp870 A T 17: 32,883,762 C198S possibly damaging Het
Zfyve26 C T 12: 79,287,807 E146K probably benign Het
Zkscan6 T C 11: 65,828,531 V459A probably damaging Het
Other mutations in Ctnnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0092:Ctnnb1 UTSW 9 120952863 missense possibly damaging 0.78
R0326:Ctnnb1 UTSW 9 120951712 missense probably benign 0.01
R0561:Ctnnb1 UTSW 9 120951722 missense probably damaging 0.97
R1017:Ctnnb1 UTSW 9 120950728 missense probably damaging 0.99
R1918:Ctnnb1 UTSW 9 120951034 missense possibly damaging 0.80
R3892:Ctnnb1 UTSW 9 120950514 splice site probably benign
R3915:Ctnnb1 UTSW 9 120955651 missense probably benign 0.00
R4869:Ctnnb1 UTSW 9 120952994 missense possibly damaging 0.93
R5707:Ctnnb1 UTSW 9 120955168 missense probably benign 0.01
R6744:Ctnnb1 UTSW 9 120952959 missense probably damaging 0.99
R7707:Ctnnb1 UTSW 9 120952865 missense possibly damaging 0.77
R8434:Ctnnb1 UTSW 9 120957562 missense possibly damaging 0.82
R8796:Ctnnb1 UTSW 9 120955432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGACTCTCAGAAACCTTTCAG -3'
(R):5'- CCATAATGAAGGCGAACGGC -3'

Sequencing Primer
(F):5'- TTTCAGATGCAGCGACTAAGC -3'
(R):5'- AGGCGAACGGCATTCTG -3'
Posted On2019-10-07