Incidental Mutation 'R7466:Prep'
ID578786
Institutional Source Beutler Lab
Gene Symbol Prep
Ensembl Gene ENSMUSG00000019849
Gene Nameprolyl endopeptidase
Synonymsprolyl oligopeptidase, Pop, D10Wsu136e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7466 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location45067203-45167198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45150438 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 486 (V486A)
Ref Sequence ENSEMBL: ENSMUSP00000097444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099858]
Predicted Effect probably benign
Transcript: ENSMUST00000099858
AA Change: V486A

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097444
Gene: ENSMUSG00000019849
AA Change: V486A

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 7 423 1.2e-170 PFAM
Pfam:Peptidase_S9 482 707 1.7e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic prolyl endopeptidase that cleaves peptide bonds on the C-terminal side of prolyl residues within peptides that are up to approximately 30 amino acids long. Prolyl endopeptidases have been reported to be involved in the maturation and degradation of peptide hormones and neuropeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit sex-dependent resistance to diet-induced obesity and adiposity. Mice heterozygous for a gene trap allele exhibit maternal inheritance influenced increase in body weight, organ weight, and adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 35,088,741 K203* probably null Het
Akr1c13 T C 13: 4,192,437 probably benign Het
Amer3 A G 1: 34,587,993 S438G probably damaging Het
Aqp9 T A 9: 71,163,261 probably null Het
Art4 G T 6: 136,854,850 H98N probably damaging Het
Bdh1 T C 16: 31,447,604 S70P probably benign Het
Ccdc61 A C 7: 18,891,105 Y503D probably damaging Het
Cd163l1 T C 7: 140,220,706 probably null Het
Cd180 A T 13: 102,704,995 N183I probably damaging Het
Cd200r2 C T 16: 44,909,174 A64V probably damaging Het
Ceacam9 A C 7: 16,723,855 K98Q probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Cfap77 G T 2: 28,955,613 D247E probably benign Het
Cftr T C 6: 18,227,973 M388T probably benign Het
Chrnb1 G A 11: 69,784,650 H493Y probably damaging Het
Ckap2 A C 8: 22,177,386 M153R probably benign Het
Cnot6l A G 5: 96,131,128 V77A probably benign Het
Col12a1 C T 9: 79,655,407 E1798K possibly damaging Het
Cth T A 3: 157,924,885 D49V probably benign Het
Ctnnb1 T C 9: 120,955,416 S425P probably damaging Het
Ctnnd1 T C 2: 84,610,785 N690S probably benign Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dennd4c A G 4: 86,774,331 D26G probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Eef2k A G 7: 120,903,484 probably null Het
Ephb2 C T 4: 136,659,065 R791H probably damaging Het
Erh T C 12: 80,640,983 Y22C probably benign Het
F5 C T 1: 164,193,328 T1124I possibly damaging Het
Fam220a T A 5: 143,563,471 C213S possibly damaging Het
Fat2 G T 11: 55,310,432 N605K probably damaging Het
Ganab C A 19: 8,914,569 S780* probably null Het
Gbgt1 C T 2: 28,502,207 P67S probably damaging Het
Gm17190 G T 13: 96,082,779 G208* probably null Het
Grhl2 A G 15: 37,291,616 Y316C probably damaging Het
H2-T10 T C 17: 36,120,849 T38A probably benign Het
Ins1 A G 19: 52,264,420 probably benign Het
Ippk T C 13: 49,432,467 probably null Het
Klc4 T A 17: 46,639,910 I258F probably benign Het
Manba C A 3: 135,542,393 L348I probably benign Het
Mgam A G 6: 40,744,789 N347S probably benign Het
Myo18b T C 5: 112,723,892 T2108A probably benign Het
Naip5 A T 13: 100,221,986 L914* probably null Het
Nsa2 C T 13: 97,131,220 A242T probably benign Het
Nsd2 G A 5: 33,882,147 W834* probably null Het
Olfr1134 T C 2: 87,656,396 N175S possibly damaging Het
Olfr1419 T A 19: 11,870,316 D300V possibly damaging Het
Olfr285 T C 15: 98,313,380 M57V probably damaging Het
Olfr469 A T 7: 107,822,922 C182* probably null Het
Pam A T 1: 97,842,247 D599E probably damaging Het
Phf20l1 A G 15: 66,636,884 K864R probably damaging Het
Plcl2 A G 17: 50,608,468 D835G probably damaging Het
Ppm1m C A 9: 106,196,157 A329S probably damaging Het
Prkcb A T 7: 122,516,844 N182I probably damaging Het
Prkcz A G 4: 155,271,602 F355S probably damaging Het
Psg20 C T 7: 18,684,467 S125N probably benign Het
Psmd12 A G 11: 107,492,057 D234G probably benign Het
Pvrig A T 5: 138,342,008 M14L probably benign Het
Rabgap1l C T 1: 160,226,484 probably null Het
Rfc1 A T 5: 65,275,426 C764S probably damaging Het
Ryr3 T C 2: 112,926,957 D351G probably benign Het
Serpinb9g T C 13: 33,495,167 F340S probably benign Het
Sirpb1c C A 3: 15,832,266 L315F probably damaging Het
Slc24a1 C G 9: 64,928,404 E814Q unknown Het
Slc26a11 A T 11: 119,374,502 Q355L probably damaging Het
Sp100 C T 1: 85,707,239 L483F possibly damaging Het
St5 A G 7: 109,525,346 L1096P probably damaging Het
Ston1 T A 17: 88,635,901 M245K probably benign Het
Swap70 T A 7: 110,274,772 D442E probably benign Het
Syne2 T A 12: 76,046,186 V450D possibly damaging Het
Tbck T A 3: 132,752,563 N651K probably damaging Het
Timd4 A T 11: 46,817,758 T204S probably benign Het
Tmem102 A G 11: 69,804,885 L87P probably damaging Het
Tmem55a T A 4: 14,912,477 Y195* probably null Het
Tmprss11e T A 5: 86,709,480 T325S probably benign Het
Trpm1 G A 7: 64,240,582 V978M probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Wdr35 G A 12: 9,005,773 V482I probably benign Het
Wdr63 T C 3: 146,055,618 D661G probably benign Het
Zer1 T C 2: 30,101,484 probably null Het
Zfp503 T C 14: 21,986,011 D279G probably benign Het
Zfp870 A T 17: 32,883,762 C198S possibly damaging Het
Zfyve26 C T 12: 79,287,807 E146K probably benign Het
Zkscan6 T C 11: 65,828,531 V459A probably damaging Het
Other mutations in Prep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Prep APN 10 45115173 missense probably damaging 1.00
IGL01412:Prep APN 10 45153112 missense probably damaging 1.00
IGL01577:Prep APN 10 45072048 splice site probably benign
IGL02751:Prep APN 10 45115186 missense probably damaging 1.00
IGL02754:Prep APN 10 45067332 start codon destroyed probably null 0.23
IGL02875:Prep APN 10 45158433 missense probably damaging 1.00
IGL02957:Prep APN 10 45126030 missense probably benign 0.44
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0167:Prep UTSW 10 45158230 critical splice acceptor site probably null
R0396:Prep UTSW 10 45092676 missense probably damaging 1.00
R0828:Prep UTSW 10 45155525 missense probably benign 0.01
R1309:Prep UTSW 10 45126026 missense probably benign
R2166:Prep UTSW 10 45092655 splice site probably benign
R4020:Prep UTSW 10 45092798 splice site probably benign
R4058:Prep UTSW 10 45158371 missense probably benign 0.29
R4162:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4163:Prep UTSW 10 45067340 missense probably benign
R4163:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4328:Prep UTSW 10 45120649 missense probably benign
R4343:Prep UTSW 10 45120770 missense probably damaging 0.99
R4493:Prep UTSW 10 45120819 missense probably benign 0.38
R4495:Prep UTSW 10 45120819 missense probably benign 0.38
R5192:Prep UTSW 10 45153111 missense probably benign 0.28
R5569:Prep UTSW 10 45097437 missense probably benign
R5888:Prep UTSW 10 45067364 missense possibly damaging 0.74
R5999:Prep UTSW 10 45072129 critical splice donor site probably null
R6468:Prep UTSW 10 45115107 missense probably damaging 1.00
R6556:Prep UTSW 10 45158314 frame shift probably null
R6696:Prep UTSW 10 45153078 missense probably damaging 1.00
R6737:Prep UTSW 10 45097495 missense possibly damaging 0.62
R6762:Prep UTSW 10 45148123 critical splice donor site probably null
R6830:Prep UTSW 10 45097501 missense probably benign 0.01
R7105:Prep UTSW 10 45126063 missense probably benign
R7193:Prep UTSW 10 45092699 missense probably benign 0.00
R7492:Prep UTSW 10 45120814 missense probably damaging 1.00
R7553:Prep UTSW 10 45158524 makesense probably null
R7860:Prep UTSW 10 45091012 missense probably damaging 1.00
R8544:Prep UTSW 10 45153127 missense probably damaging 1.00
R8808:Prep UTSW 10 45095156 nonsense probably null
Z1176:Prep UTSW 10 45150468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTTTGTAGGCAAATGGTAATC -3'
(R):5'- TTCTGCCGAAAAGCTCTCGC -3'

Sequencing Primer
(F):5'- GGTAATCAGAAGTTACGTGTCTTTC -3'
(R):5'- TCTCCACCCAGCTTGCTGG -3'
Posted On2019-10-07