Incidental Mutation 'R7466:Timd4'
ID578787
Institutional Source Beutler Lab
Gene Symbol Timd4
Ensembl Gene ENSMUSG00000055546
Gene NameT cell immunoglobulin and mucin domain containing 4
SynonymsTim4, B430010N18Rik, TIM-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7466 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46810800-46844332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46817758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 204 (T204S)
Ref Sequence ENSEMBL: ENSMUSP00000069456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068877]
PDB Structure
Tim-4 [X-RAY DIFFRACTION]
Tim-4 in complex with sodium potassium tartrate [X-RAY DIFFRACTION]
Tim-4 in complex with phosphatidylserine [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000068877
AA Change: T204S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000069456
Gene: ENSMUSG00000055546
AA Change: T204S

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
IG 25 132 3.59e-5 SMART
low complexity region 135 182 N/A INTRINSIC
low complexity region 248 271 N/A INTRINSIC
transmembrane domain 279 301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage phagocytosis, altered macrophage physiology, and increased peritoneal lymphoid and meyloid cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 35,088,741 K203* probably null Het
Akr1c13 T C 13: 4,192,437 probably benign Het
Amer3 A G 1: 34,587,993 S438G probably damaging Het
Aqp9 T A 9: 71,163,261 probably null Het
Art4 G T 6: 136,854,850 H98N probably damaging Het
Bdh1 T C 16: 31,447,604 S70P probably benign Het
Ccdc61 A C 7: 18,891,105 Y503D probably damaging Het
Cd163l1 T C 7: 140,220,706 probably null Het
Cd180 A T 13: 102,704,995 N183I probably damaging Het
Cd200r2 C T 16: 44,909,174 A64V probably damaging Het
Ceacam9 A C 7: 16,723,855 K98Q probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Cfap77 G T 2: 28,955,613 D247E probably benign Het
Cftr T C 6: 18,227,973 M388T probably benign Het
Chrnb1 G A 11: 69,784,650 H493Y probably damaging Het
Ckap2 A C 8: 22,177,386 M153R probably benign Het
Cnot6l A G 5: 96,131,128 V77A probably benign Het
Col12a1 C T 9: 79,655,407 E1798K possibly damaging Het
Cth T A 3: 157,924,885 D49V probably benign Het
Ctnnb1 T C 9: 120,955,416 S425P probably damaging Het
Ctnnd1 T C 2: 84,610,785 N690S probably benign Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dennd4c A G 4: 86,774,331 D26G probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Eef2k A G 7: 120,903,484 probably null Het
Ephb2 C T 4: 136,659,065 R791H probably damaging Het
Erh T C 12: 80,640,983 Y22C probably benign Het
F5 C T 1: 164,193,328 T1124I possibly damaging Het
Fam220a T A 5: 143,563,471 C213S possibly damaging Het
Fat2 G T 11: 55,310,432 N605K probably damaging Het
Ganab C A 19: 8,914,569 S780* probably null Het
Gbgt1 C T 2: 28,502,207 P67S probably damaging Het
Gm17190 G T 13: 96,082,779 G208* probably null Het
Grhl2 A G 15: 37,291,616 Y316C probably damaging Het
H2-T10 T C 17: 36,120,849 T38A probably benign Het
Ins1 A G 19: 52,264,420 probably benign Het
Ippk T C 13: 49,432,467 probably null Het
Klc4 T A 17: 46,639,910 I258F probably benign Het
Manba C A 3: 135,542,393 L348I probably benign Het
Mgam A G 6: 40,744,789 N347S probably benign Het
Myo18b T C 5: 112,723,892 T2108A probably benign Het
Naip5 A T 13: 100,221,986 L914* probably null Het
Nsa2 C T 13: 97,131,220 A242T probably benign Het
Nsd2 G A 5: 33,882,147 W834* probably null Het
Olfr1134 T C 2: 87,656,396 N175S possibly damaging Het
Olfr1419 T A 19: 11,870,316 D300V possibly damaging Het
Olfr285 T C 15: 98,313,380 M57V probably damaging Het
Olfr469 A T 7: 107,822,922 C182* probably null Het
Pam A T 1: 97,842,247 D599E probably damaging Het
Phf20l1 A G 15: 66,636,884 K864R probably damaging Het
Plcl2 A G 17: 50,608,468 D835G probably damaging Het
Ppm1m C A 9: 106,196,157 A329S probably damaging Het
Prep T C 10: 45,150,438 V486A probably benign Het
Prkcb A T 7: 122,516,844 N182I probably damaging Het
Prkcz A G 4: 155,271,602 F355S probably damaging Het
Psg20 C T 7: 18,684,467 S125N probably benign Het
Psmd12 A G 11: 107,492,057 D234G probably benign Het
Pvrig A T 5: 138,342,008 M14L probably benign Het
Rabgap1l C T 1: 160,226,484 probably null Het
Rfc1 A T 5: 65,275,426 C764S probably damaging Het
Ryr3 T C 2: 112,926,957 D351G probably benign Het
Serpinb9g T C 13: 33,495,167 F340S probably benign Het
Sirpb1c C A 3: 15,832,266 L315F probably damaging Het
Slc24a1 C G 9: 64,928,404 E814Q unknown Het
Slc26a11 A T 11: 119,374,502 Q355L probably damaging Het
Sp100 C T 1: 85,707,239 L483F possibly damaging Het
St5 A G 7: 109,525,346 L1096P probably damaging Het
Ston1 T A 17: 88,635,901 M245K probably benign Het
Swap70 T A 7: 110,274,772 D442E probably benign Het
Syne2 T A 12: 76,046,186 V450D possibly damaging Het
Tbck T A 3: 132,752,563 N651K probably damaging Het
Tmem102 A G 11: 69,804,885 L87P probably damaging Het
Tmem55a T A 4: 14,912,477 Y195* probably null Het
Tmprss11e T A 5: 86,709,480 T325S probably benign Het
Trpm1 G A 7: 64,240,582 V978M probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Wdr35 G A 12: 9,005,773 V482I probably benign Het
Wdr63 T C 3: 146,055,618 D661G probably benign Het
Zer1 T C 2: 30,101,484 probably null Het
Zfp503 T C 14: 21,986,011 D279G probably benign Het
Zfp870 A T 17: 32,883,762 C198S possibly damaging Het
Zfyve26 C T 12: 79,287,807 E146K probably benign Het
Zkscan6 T C 11: 65,828,531 V459A probably damaging Het
Other mutations in Timd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Timd4 APN 11 46820014 missense possibly damaging 0.61
IGL02247:Timd4 APN 11 46815731 missense probably damaging 1.00
IGL02803:Timd4 APN 11 46815694 missense probably damaging 1.00
IGL02991:Timd4 APN 11 46842147 splice site probably benign
R0318:Timd4 UTSW 11 46837071 missense probably benign 0.00
R0427:Timd4 UTSW 11 46819257 missense probably benign 0.00
R1175:Timd4 UTSW 11 46817671 missense probably damaging 1.00
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1635:Timd4 UTSW 11 46842162 missense possibly damaging 0.92
R2011:Timd4 UTSW 11 46820030 missense possibly damaging 0.79
R2012:Timd4 UTSW 11 46820030 missense possibly damaging 0.79
R4994:Timd4 UTSW 11 46815517 missense probably damaging 0.99
R5511:Timd4 UTSW 11 46819980 splice site probably null
R5739:Timd4 UTSW 11 46817746 missense probably benign 0.10
R5991:Timd4 UTSW 11 46843203 makesense probably null
R6207:Timd4 UTSW 11 46815526 missense probably damaging 0.98
R6863:Timd4 UTSW 11 46815443 nonsense probably null
R7230:Timd4 UTSW 11 46810864 missense probably benign 0.01
R7254:Timd4 UTSW 11 46843189 missense probably benign 0.04
R7750:Timd4 UTSW 11 46815527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGACCGATGCATCTTCTG -3'
(R):5'- TGGAGAACCCAAAATGCTGAC -3'

Sequencing Primer
(F):5'- TGTTGGTTACAGCCACAACAAC -3'
(R):5'- GGAGAACCCAAAATGCTGACTTTTC -3'
Posted On2019-10-07