Incidental Mutation 'R7466:Chrnb1'
ID 578790
Institutional Source Beutler Lab
Gene Symbol Chrnb1
Ensembl Gene ENSMUSG00000041189
Gene Name cholinergic receptor nicotinic beta 1 subunit
Synonyms Acrb, Achr-2, AChR beta
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.871) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69674862-69686742 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69675476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 493 (H493Y)
Ref Sequence ENSEMBL: ENSMUSP00000047270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045971] [ENSMUST00000108638] [ENSMUST00000108639] [ENSMUST00000108640] [ENSMUST00000108642]
AlphaFold P09690
Predicted Effect probably damaging
Transcript: ENSMUST00000045971
AA Change: H493Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189
AA Change: H493Y

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108638
SMART Domains Protein: ENSMUSP00000104278
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108639
SMART Domains Protein: ENSMUSP00000104279
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108640
SMART Domains Protein: ENSMUSP00000104280
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108642
SMART Domains Protein: ENSMUSP00000104282
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele lack all tyrosine residues in the beta subunit intracellular loop, display reduced and simplified neuromuscular junctions, and show defective acetylcholine receptor clustering and anchoring at synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Cftr T C 6: 18,227,972 (GRCm39) M388T probably benign Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd2b A G 7: 109,124,553 (GRCm39) L1096P probably damaging Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Manba C A 3: 135,248,154 (GRCm39) L348I probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Nsd2 G A 5: 34,039,491 (GRCm39) W834* probably null Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcb A T 7: 122,116,067 (GRCm39) N182I probably damaging Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc24a1 C G 9: 64,835,686 (GRCm39) E814Q unknown Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve26 C T 12: 79,334,581 (GRCm39) E146K probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Chrnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Chrnb1 APN 11 69,684,742 (GRCm39) missense probably damaging 1.00
IGL01924:Chrnb1 APN 11 69,685,845 (GRCm39) unclassified probably benign
IGL01983:Chrnb1 APN 11 69,686,555 (GRCm39) missense probably benign 0.27
IGL02100:Chrnb1 APN 11 69,684,281 (GRCm39) unclassified probably benign
IGL02507:Chrnb1 APN 11 69,675,916 (GRCm39) missense probably damaging 1.00
IGL02814:Chrnb1 APN 11 69,686,506 (GRCm39) missense probably damaging 1.00
IGL02858:Chrnb1 APN 11 69,675,935 (GRCm39) missense possibly damaging 0.58
R0368:Chrnb1 UTSW 11 69,675,583 (GRCm39) missense probably damaging 1.00
R1728:Chrnb1 UTSW 11 69,676,588 (GRCm39) missense probably damaging 1.00
R1913:Chrnb1 UTSW 11 69,684,410 (GRCm39) missense possibly damaging 0.95
R1930:Chrnb1 UTSW 11 69,683,563 (GRCm39) missense possibly damaging 0.81
R2233:Chrnb1 UTSW 11 69,686,428 (GRCm39) missense probably damaging 0.98
R2234:Chrnb1 UTSW 11 69,686,428 (GRCm39) missense probably damaging 0.98
R3971:Chrnb1 UTSW 11 69,683,742 (GRCm39) unclassified probably benign
R4183:Chrnb1 UTSW 11 69,677,922 (GRCm39) missense possibly damaging 0.50
R4425:Chrnb1 UTSW 11 69,677,773 (GRCm39) missense probably damaging 1.00
R4822:Chrnb1 UTSW 11 69,686,501 (GRCm39) missense possibly damaging 0.55
R4983:Chrnb1 UTSW 11 69,684,804 (GRCm39) missense probably damaging 1.00
R5000:Chrnb1 UTSW 11 69,677,858 (GRCm39) missense probably damaging 0.96
R5378:Chrnb1 UTSW 11 69,676,007 (GRCm39) missense probably benign 0.00
R5396:Chrnb1 UTSW 11 69,684,979 (GRCm39) missense probably damaging 1.00
R5540:Chrnb1 UTSW 11 69,686,476 (GRCm39) missense probably benign 0.30
R5574:Chrnb1 UTSW 11 69,684,509 (GRCm39) unclassified probably benign
R5890:Chrnb1 UTSW 11 69,683,555 (GRCm39) missense possibly damaging 0.94
R5973:Chrnb1 UTSW 11 69,686,671 (GRCm39) unclassified probably benign
R6056:Chrnb1 UTSW 11 69,677,765 (GRCm39) missense probably damaging 1.00
R7633:Chrnb1 UTSW 11 69,683,699 (GRCm39) missense probably damaging 1.00
R7664:Chrnb1 UTSW 11 69,677,850 (GRCm39) missense possibly damaging 0.80
R8266:Chrnb1 UTSW 11 69,675,447 (GRCm39) makesense probably null
R9124:Chrnb1 UTSW 11 69,685,057 (GRCm39) missense probably benign 0.31
Z1177:Chrnb1 UTSW 11 69,685,015 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGGACATTTCGGGTGGGTC -3'
(R):5'- GAGCCTTACTTTTGCGCTAC -3'

Sequencing Primer
(F):5'- GTCCAAGGCACCATGCTCAG -3'
(R):5'- TTCCAAGTAACAATACCTTGGCAG -3'
Posted On 2019-10-07