Incidental Mutation 'R7466:Zfyve26'
ID 578796
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Name zinc finger, FYVE domain containing 26
Synonyms A630028O16Rik, 9330197E15Rik, LOC380767
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 79279120-79343078 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79334581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 146 (E146K)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]
AlphaFold Q5DU37
Predicted Effect probably benign
Transcript: ENSMUST00000021547
AA Change: E146K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: E146K

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
AA Change: E146K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 34,978,753 (GRCm39) K203* probably null Het
Akr1c13 T C 13: 4,242,436 (GRCm39) probably benign Het
Amer3 A G 1: 34,627,074 (GRCm39) S438G probably damaging Het
Aqp9 T A 9: 71,070,543 (GRCm39) probably null Het
Art4 G T 6: 136,831,848 (GRCm39) H98N probably damaging Het
Bdh1 T C 16: 31,266,422 (GRCm39) S70P probably benign Het
Ccdc61 A C 7: 18,625,030 (GRCm39) Y503D probably damaging Het
Cd180 A T 13: 102,841,503 (GRCm39) N183I probably damaging Het
Cd200r2 C T 16: 44,729,537 (GRCm39) A64V probably damaging Het
Ceacam9 A C 7: 16,457,780 (GRCm39) K98Q probably benign Het
Cep44 AACGC A 8: 56,994,018 (GRCm39) probably null Het
Cfap77 G T 2: 28,845,625 (GRCm39) D247E probably benign Het
Cftr T C 6: 18,227,972 (GRCm39) M388T probably benign Het
Chrnb1 G A 11: 69,675,476 (GRCm39) H493Y probably damaging Het
Ckap2 A C 8: 22,667,402 (GRCm39) M153R probably benign Het
Cnot6l A G 5: 96,278,987 (GRCm39) V77A probably benign Het
Col12a1 C T 9: 79,562,689 (GRCm39) E1798K possibly damaging Het
Cth T A 3: 157,630,522 (GRCm39) D49V probably benign Het
Ctnnb1 T C 9: 120,784,482 (GRCm39) S425P probably damaging Het
Ctnnd1 T C 2: 84,441,129 (GRCm39) N690S probably benign Het
Dennd2b A G 7: 109,124,553 (GRCm39) L1096P probably damaging Het
Dennd4c A G 4: 86,692,568 (GRCm39) D26G probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnai3 T C 3: 145,761,373 (GRCm39) D661G probably benign Het
Eef2k A G 7: 120,502,707 (GRCm39) probably null Het
Ephb2 C T 4: 136,386,376 (GRCm39) R791H probably damaging Het
Erh T C 12: 80,687,757 (GRCm39) Y22C probably benign Het
F5 C T 1: 164,020,897 (GRCm39) T1124I possibly damaging Het
Fam220a T A 5: 143,549,226 (GRCm39) C213S possibly damaging Het
Fat2 G T 11: 55,201,258 (GRCm39) N605K probably damaging Het
Ganab C A 19: 8,891,933 (GRCm39) S780* probably null Het
Gbgt1 C T 2: 28,392,219 (GRCm39) P67S probably damaging Het
Gm17190 G T 13: 96,219,287 (GRCm39) G208* probably null Het
Grhl2 A G 15: 37,291,860 (GRCm39) Y316C probably damaging Het
H2-T10 T C 17: 36,431,741 (GRCm39) T38A probably benign Het
Ins1 A G 19: 52,252,858 (GRCm39) probably benign Het
Ippk T C 13: 49,585,943 (GRCm39) probably null Het
Klc4 T A 17: 46,950,836 (GRCm39) I258F probably benign Het
Manba C A 3: 135,248,154 (GRCm39) L348I probably benign Het
Mgam A G 6: 40,721,723 (GRCm39) N347S probably benign Het
Myo18b T C 5: 112,871,758 (GRCm39) T2108A probably benign Het
Naip5 A T 13: 100,358,494 (GRCm39) L914* probably null Het
Nsa2 C T 13: 97,267,728 (GRCm39) A242T probably benign Het
Nsd2 G A 5: 34,039,491 (GRCm39) W834* probably null Het
Or10q3 T A 19: 11,847,680 (GRCm39) D300V possibly damaging Het
Or5p50 A T 7: 107,422,129 (GRCm39) C182* probably null Het
Or5w1 T C 2: 87,486,740 (GRCm39) N175S possibly damaging Het
Or8s16 T C 15: 98,211,261 (GRCm39) M57V probably damaging Het
Pam A T 1: 97,769,972 (GRCm39) D599E probably damaging Het
Phf20l1 A G 15: 66,508,733 (GRCm39) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm39) Y195* probably null Het
Plcl2 A G 17: 50,915,496 (GRCm39) D835G probably damaging Het
Ppm1m C A 9: 106,073,356 (GRCm39) A329S probably damaging Het
Prep T C 10: 45,026,534 (GRCm39) V486A probably benign Het
Prkcb A T 7: 122,116,067 (GRCm39) N182I probably damaging Het
Prkcz A G 4: 155,356,059 (GRCm39) F355S probably damaging Het
Psg20 C T 7: 18,418,392 (GRCm39) S125N probably benign Het
Psmd12 A G 11: 107,382,883 (GRCm39) D234G probably benign Het
Pvrig-ps A T 5: 138,340,270 (GRCm39) M14L probably benign Het
Rabgap1l C T 1: 160,054,054 (GRCm39) probably null Het
Rfc1 A T 5: 65,432,769 (GRCm39) C764S probably damaging Het
Ryr3 T C 2: 112,757,302 (GRCm39) D351G probably benign Het
Scart1 T C 7: 139,800,619 (GRCm39) probably null Het
Serpinb9g T C 13: 33,679,150 (GRCm39) F340S probably benign Het
Sirpb1c C A 3: 15,886,430 (GRCm39) L315F probably damaging Het
Slc24a1 C G 9: 64,835,686 (GRCm39) E814Q unknown Het
Slc26a11 A T 11: 119,265,328 (GRCm39) Q355L probably damaging Het
Sp100 C T 1: 85,634,960 (GRCm39) L483F possibly damaging Het
Ston1 T A 17: 88,943,329 (GRCm39) M245K probably benign Het
Swap70 T A 7: 109,873,979 (GRCm39) D442E probably benign Het
Syne2 T A 12: 76,092,960 (GRCm39) V450D possibly damaging Het
Tbck T A 3: 132,458,324 (GRCm39) N651K probably damaging Het
Timd4 A T 11: 46,708,585 (GRCm39) T204S probably benign Het
Tmem102 A G 11: 69,695,711 (GRCm39) L87P probably damaging Het
Tmprss11e T A 5: 86,857,339 (GRCm39) T325S probably benign Het
Trpm1 G A 7: 63,890,330 (GRCm39) V978M probably damaging Het
Wdr12 A T 1: 60,133,670 (GRCm39) D19E probably benign Het
Wdr35 G A 12: 9,055,773 (GRCm39) V482I probably benign Het
Zer1 T C 2: 29,991,496 (GRCm39) probably null Het
Zfp503 T C 14: 22,036,079 (GRCm39) D279G probably benign Het
Zfp870 A T 17: 33,102,736 (GRCm39) C198S possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zkscan6 T C 11: 65,719,357 (GRCm39) V459A probably damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79,296,234 (GRCm39) unclassified probably benign
IGL00940:Zfyve26 APN 12 79,327,674 (GRCm39) missense probably benign
IGL01148:Zfyve26 APN 12 79,307,644 (GRCm39) missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79,298,957 (GRCm39) splice site probably null
IGL01472:Zfyve26 APN 12 79,323,117 (GRCm39) missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79,291,147 (GRCm39) missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79,334,625 (GRCm39) missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79,308,348 (GRCm39) splice site probably null
IGL01689:Zfyve26 APN 12 79,330,827 (GRCm39) missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79,334,218 (GRCm39) missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79,291,174 (GRCm39) missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79,323,169 (GRCm39) missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79,315,621 (GRCm39) missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79,326,854 (GRCm39) missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79,285,794 (GRCm39) missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79,310,644 (GRCm39) missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79,308,565 (GRCm39) missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79,342,338 (GRCm39) missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79,330,846 (GRCm39) nonsense probably null
challenge UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
fourteener UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
IGL02799:Zfyve26 UTSW 12 79,320,084 (GRCm39) missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79,323,055 (GRCm39) missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79,291,258 (GRCm39) missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79,292,996 (GRCm39) missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79,315,502 (GRCm39) missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79,312,576 (GRCm39) splice site probably benign
R0738:Zfyve26 UTSW 12 79,342,308 (GRCm39) missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79,320,372 (GRCm39) missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79,318,901 (GRCm39) missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79,310,723 (GRCm39) missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79,321,694 (GRCm39) missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79,329,591 (GRCm39) missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79,298,937 (GRCm39) missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79,298,925 (GRCm39) missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79,334,535 (GRCm39) missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79,285,718 (GRCm39) missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79,325,237 (GRCm39) missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79,315,823 (GRCm39) missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79,333,032 (GRCm39) missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79,311,125 (GRCm39) missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79,286,744 (GRCm39) nonsense probably null
R1982:Zfyve26 UTSW 12 79,302,017 (GRCm39) missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79,330,806 (GRCm39) splice site probably null
R2071:Zfyve26 UTSW 12 79,334,220 (GRCm39) missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79,292,826 (GRCm39) missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79,292,861 (GRCm39) missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79,321,814 (GRCm39) missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79,330,890 (GRCm39) missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79,329,573 (GRCm39) splice site probably null
R3084:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R3086:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R4626:Zfyve26 UTSW 12 79,315,844 (GRCm39) missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79,291,170 (GRCm39) missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79,296,469 (GRCm39) splice site probably null
R4926:Zfyve26 UTSW 12 79,321,785 (GRCm39) missense probably benign
R4990:Zfyve26 UTSW 12 79,334,607 (GRCm39) missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79,327,159 (GRCm39) nonsense probably null
R5029:Zfyve26 UTSW 12 79,333,097 (GRCm39) missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79,302,135 (GRCm39) missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79,326,832 (GRCm39) nonsense probably null
R5252:Zfyve26 UTSW 12 79,315,756 (GRCm39) missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79,317,624 (GRCm39) missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79,293,295 (GRCm39) missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79,286,698 (GRCm39) missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79,320,147 (GRCm39) missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79,311,131 (GRCm39) missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79,334,511 (GRCm39) missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79,313,311 (GRCm39) missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79,340,628 (GRCm39) missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79,315,501 (GRCm39) missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79,296,373 (GRCm39) missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79,286,776 (GRCm39) missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79,285,109 (GRCm39) missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79,313,223 (GRCm39) missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79,330,926 (GRCm39) missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79,325,888 (GRCm39) missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79,327,179 (GRCm39) missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79,315,182 (GRCm39) missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79,292,945 (GRCm39) missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79,325,146 (GRCm39) splice site probably null
R7299:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79,297,942 (GRCm39) missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79,286,828 (GRCm39) missense probably damaging 1.00
R7540:Zfyve26 UTSW 12 79,315,450 (GRCm39) missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79,337,731 (GRCm39) missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79,315,409 (GRCm39) missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79,327,129 (GRCm39) critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79,302,098 (GRCm39) missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79,315,331 (GRCm39) missense possibly damaging 0.79
R8190:Zfyve26 UTSW 12 79,327,610 (GRCm39) missense probably benign 0.00
R8207:Zfyve26 UTSW 12 79,307,605 (GRCm39) missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
R8500:Zfyve26 UTSW 12 79,334,454 (GRCm39) missense probably damaging 0.99
R8686:Zfyve26 UTSW 12 79,334,227 (GRCm39) missense probably benign
R8758:Zfyve26 UTSW 12 79,311,083 (GRCm39) critical splice donor site probably benign
R8826:Zfyve26 UTSW 12 79,285,742 (GRCm39) missense probably benign 0.05
R8877:Zfyve26 UTSW 12 79,334,152 (GRCm39) missense probably benign 0.05
R9067:Zfyve26 UTSW 12 79,318,915 (GRCm39) missense probably damaging 0.99
R9195:Zfyve26 UTSW 12 79,311,168 (GRCm39) missense probably benign 0.12
R9269:Zfyve26 UTSW 12 79,323,076 (GRCm39) missense possibly damaging 0.73
R9273:Zfyve26 UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
R9340:Zfyve26 UTSW 12 79,321,680 (GRCm39) nonsense probably null
R9348:Zfyve26 UTSW 12 79,315,231 (GRCm39) missense possibly damaging 0.81
R9482:Zfyve26 UTSW 12 79,291,239 (GRCm39) missense probably damaging 1.00
R9536:Zfyve26 UTSW 12 79,298,046 (GRCm39) missense probably benign 0.32
R9653:Zfyve26 UTSW 12 79,334,418 (GRCm39) missense probably benign
R9676:Zfyve26 UTSW 12 79,330,959 (GRCm39) missense probably benign 0.01
R9797:Zfyve26 UTSW 12 79,293,006 (GRCm39) missense probably damaging 0.98
RF010:Zfyve26 UTSW 12 79,302,112 (GRCm39) missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79,285,779 (GRCm39) missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79,315,307 (GRCm39) missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79,334,149 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGCAGCATAGAGCCTG -3'
(R):5'- GCATACATTTTGGGGAAAGTGG -3'

Sequencing Primer
(F):5'- CTGAAGGGCTCCACAGACAG -3'
(R):5'- ACTTGGGTAACTGGGCTAATCAC -3'
Posted On 2019-10-07