Incidental Mutation 'R7466:Erh'
ID 578797
Institutional Source Beutler Lab
Gene Symbol Erh
Ensembl Gene ENSMUSG00000021131
Gene Name ERH mRNA splicing and mitosis factor
Synonyms Prei1, Mer
MMRRC Submission 045540-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R7466 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 80634022-80644341 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80640983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 22 (Y22C)
Ref Sequence ENSEMBL: ENSMUSP00000021559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021559] [ENSMUST00000085245] [ENSMUST00000166931] [ENSMUST00000217889] [ENSMUST00000218364] [ENSMUST00000218740] [ENSMUST00000219405] [ENSMUST00000219706]
AlphaFold P84089
PDB Structure Solution Structure of Mouse ER [SOLUTION NMR]
Crystal structure of enhancer of rudimentary homologue (ERH) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021559
AA Change: Y22C

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021559
Gene: ENSMUSG00000021131
AA Change: Y22C

DomainStartEndE-ValueType
Pfam:ER 1 103 9.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085245
SMART Domains Protein: ENSMUSP00000082343
Gene: ENSMUSG00000048833

DomainStartEndE-ValueType
Pfam:Zip 4 146 2.6e-13 PFAM
Pfam:Zip 132 303 2e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166931
AA Change: Y41C

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129620
Gene: ENSMUSG00000021131
AA Change: Y41C

DomainStartEndE-ValueType
Pfam:ER 21 118 4.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217889
Predicted Effect possibly damaging
Transcript: ENSMUST00000218364
AA Change: Y22C

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000218740
AA Change: Y22C

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219405
Predicted Effect probably benign
Transcript: ENSMUST00000219706
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 35,088,741 (GRCm38) K203* probably null Het
Akr1c13 T C 13: 4,192,437 (GRCm38) probably benign Het
Amer3 A G 1: 34,587,993 (GRCm38) S438G probably damaging Het
Aqp9 T A 9: 71,163,261 (GRCm38) probably null Het
Art4 G T 6: 136,854,850 (GRCm38) H98N probably damaging Het
Bdh1 T C 16: 31,447,604 (GRCm38) S70P probably benign Het
Ccdc61 A C 7: 18,891,105 (GRCm38) Y503D probably damaging Het
Cd180 A T 13: 102,704,995 (GRCm38) N183I probably damaging Het
Cd200r2 C T 16: 44,909,174 (GRCm38) A64V probably damaging Het
Ceacam9 A C 7: 16,723,855 (GRCm38) K98Q probably benign Het
Cep44 AACGC A 8: 56,540,983 (GRCm38) probably null Het
Cfap77 G T 2: 28,955,613 (GRCm38) D247E probably benign Het
Cftr T C 6: 18,227,973 (GRCm38) M388T probably benign Het
Chrnb1 G A 11: 69,784,650 (GRCm38) H493Y probably damaging Het
Ckap2 A C 8: 22,177,386 (GRCm38) M153R probably benign Het
Cnot6l A G 5: 96,131,128 (GRCm38) V77A probably benign Het
Col12a1 C T 9: 79,655,407 (GRCm38) E1798K possibly damaging Het
Cth T A 3: 157,924,885 (GRCm38) D49V probably benign Het
Ctnnb1 T C 9: 120,955,416 (GRCm38) S425P probably damaging Het
Ctnnd1 T C 2: 84,610,785 (GRCm38) N690S probably benign Het
Dennd4c A G 4: 86,774,331 (GRCm38) D26G probably damaging Het
Dlg5 G A 14: 24,245,212 (GRCm38) P80L probably damaging Het
Dnai3 T C 3: 146,055,618 (GRCm38) D661G probably benign Het
Eef2k A G 7: 120,903,484 (GRCm38) probably null Het
Ephb2 C T 4: 136,659,065 (GRCm38) R791H probably damaging Het
F5 C T 1: 164,193,328 (GRCm38) T1124I possibly damaging Het
Fam220a T A 5: 143,563,471 (GRCm38) C213S possibly damaging Het
Fat2 G T 11: 55,310,432 (GRCm38) N605K probably damaging Het
Ganab C A 19: 8,914,569 (GRCm38) S780* probably null Het
Gbgt1 C T 2: 28,502,207 (GRCm38) P67S probably damaging Het
Gm17190 G T 13: 96,082,779 (GRCm38) G208* probably null Het
Grhl2 A G 15: 37,291,616 (GRCm38) Y316C probably damaging Het
H2-T10 T C 17: 36,120,849 (GRCm38) T38A probably benign Het
Ins1 A G 19: 52,264,420 (GRCm38) probably benign Het
Ippk T C 13: 49,432,467 (GRCm38) probably null Het
Klc4 T A 17: 46,639,910 (GRCm38) I258F probably benign Het
Manba C A 3: 135,542,393 (GRCm38) L348I probably benign Het
Mgam A G 6: 40,744,789 (GRCm38) N347S probably benign Het
Myo18b T C 5: 112,723,892 (GRCm38) T2108A probably benign Het
Naip5 A T 13: 100,221,986 (GRCm38) L914* probably null Het
Nsa2 C T 13: 97,131,220 (GRCm38) A242T probably benign Het
Nsd2 G A 5: 33,882,147 (GRCm38) W834* probably null Het
Or10q3 T A 19: 11,870,316 (GRCm38) D300V possibly damaging Het
Or5p50 A T 7: 107,822,922 (GRCm38) C182* probably null Het
Or5w1 T C 2: 87,656,396 (GRCm38) N175S possibly damaging Het
Or8s16 T C 15: 98,313,380 (GRCm38) M57V probably damaging Het
Pam A T 1: 97,842,247 (GRCm38) D599E probably damaging Het
Phf20l1 A G 15: 66,636,884 (GRCm38) K864R probably damaging Het
Pip4p2 T A 4: 14,912,477 (GRCm38) Y195* probably null Het
Plcl2 A G 17: 50,608,468 (GRCm38) D835G probably damaging Het
Ppm1m C A 9: 106,196,157 (GRCm38) A329S probably damaging Het
Prep T C 10: 45,150,438 (GRCm38) V486A probably benign Het
Prkcb A T 7: 122,516,844 (GRCm38) N182I probably damaging Het
Prkcz A G 4: 155,271,602 (GRCm38) F355S probably damaging Het
Psg20 C T 7: 18,684,467 (GRCm38) S125N probably benign Het
Psmd12 A G 11: 107,492,057 (GRCm38) D234G probably benign Het
Pvrig A T 5: 138,342,008 (GRCm38) M14L probably benign Het
Rabgap1l C T 1: 160,226,484 (GRCm38) probably null Het
Rfc1 A T 5: 65,275,426 (GRCm38) C764S probably damaging Het
Ryr3 T C 2: 112,926,957 (GRCm38) D351G probably benign Het
Scart1 T C 7: 140,220,706 (GRCm38) probably null Het
Serpinb9g T C 13: 33,495,167 (GRCm38) F340S probably benign Het
Sirpb1c C A 3: 15,832,266 (GRCm38) L315F probably damaging Het
Slc24a1 C G 9: 64,928,404 (GRCm38) E814Q unknown Het
Slc26a11 A T 11: 119,374,502 (GRCm38) Q355L probably damaging Het
Sp100 C T 1: 85,707,239 (GRCm38) L483F possibly damaging Het
St5 A G 7: 109,525,346 (GRCm38) L1096P probably damaging Het
Ston1 T A 17: 88,635,901 (GRCm38) M245K probably benign Het
Swap70 T A 7: 110,274,772 (GRCm38) D442E probably benign Het
Syne2 T A 12: 76,046,186 (GRCm38) V450D possibly damaging Het
Tbck T A 3: 132,752,563 (GRCm38) N651K probably damaging Het
Timd4 A T 11: 46,817,758 (GRCm38) T204S probably benign Het
Tmem102 A G 11: 69,804,885 (GRCm38) L87P probably damaging Het
Tmprss11e T A 5: 86,709,480 (GRCm38) T325S probably benign Het
Trpm1 G A 7: 64,240,582 (GRCm38) V978M probably damaging Het
Wdr12 A T 1: 60,094,511 (GRCm38) D19E probably benign Het
Wdr35 G A 12: 9,005,773 (GRCm38) V482I probably benign Het
Zer1 T C 2: 30,101,484 (GRCm38) probably null Het
Zfp503 T C 14: 21,986,011 (GRCm38) D279G probably benign Het
Zfp870 A T 17: 32,883,762 (GRCm38) C198S possibly damaging Het
Zftraf1 C T 15: 76,648,186 (GRCm38) D241N probably benign Het
Zfyve26 C T 12: 79,287,807 (GRCm38) E146K probably benign Het
Zkscan6 T C 11: 65,828,531 (GRCm38) V459A probably damaging Het
Other mutations in Erh
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2198:Erh UTSW 12 80,642,785 (GRCm38) unclassified probably benign
R4335:Erh UTSW 12 80,642,841 (GRCm38) missense probably benign 0.18
R7679:Erh UTSW 12 80,637,571 (GRCm38) missense probably benign 0.25
R8039:Erh UTSW 12 80,637,578 (GRCm38) missense probably damaging 1.00
R8912:Erh UTSW 12 80,637,508 (GRCm38) missense probably benign 0.01
R8914:Erh UTSW 12 80,637,508 (GRCm38) missense probably benign 0.01
R8917:Erh UTSW 12 80,637,508 (GRCm38) missense probably benign 0.01
R8918:Erh UTSW 12 80,637,508 (GRCm38) missense probably benign 0.01
R8968:Erh UTSW 12 80,637,508 (GRCm38) missense probably benign 0.01
R9557:Erh UTSW 12 80,642,797 (GRCm38) missense probably benign
Z1176:Erh UTSW 12 80,642,804 (GRCm38) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCAGAGCCAACGGTAACAGTG -3'
(R):5'- TGCGGATGAGCAACCTAGTC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CGGATGAGCAACCTAGTCAGTTATG -3'
Posted On 2019-10-07