Incidental Mutation 'R7466:Naip5'
ID578802
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7466 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 100221986 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 914 (L914*)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect probably null
Transcript: ENSMUST00000049789
AA Change: L914*
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: L914*

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 35,088,741 K203* probably null Het
Akr1c13 T C 13: 4,192,437 probably benign Het
Amer3 A G 1: 34,587,993 S438G probably damaging Het
Aqp9 T A 9: 71,163,261 probably null Het
Art4 G T 6: 136,854,850 H98N probably damaging Het
Bdh1 T C 16: 31,447,604 S70P probably benign Het
Ccdc61 A C 7: 18,891,105 Y503D probably damaging Het
Cd163l1 T C 7: 140,220,706 probably null Het
Cd180 A T 13: 102,704,995 N183I probably damaging Het
Cd200r2 C T 16: 44,909,174 A64V probably damaging Het
Ceacam9 A C 7: 16,723,855 K98Q probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Cfap77 G T 2: 28,955,613 D247E probably benign Het
Cftr T C 6: 18,227,973 M388T probably benign Het
Chrnb1 G A 11: 69,784,650 H493Y probably damaging Het
Ckap2 A C 8: 22,177,386 M153R probably benign Het
Cnot6l A G 5: 96,131,128 V77A probably benign Het
Col12a1 C T 9: 79,655,407 E1798K possibly damaging Het
Cth T A 3: 157,924,885 D49V probably benign Het
Ctnnb1 T C 9: 120,955,416 S425P probably damaging Het
Ctnnd1 T C 2: 84,610,785 N690S probably benign Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dennd4c A G 4: 86,774,331 D26G probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Eef2k A G 7: 120,903,484 probably null Het
Ephb2 C T 4: 136,659,065 R791H probably damaging Het
Erh T C 12: 80,640,983 Y22C probably benign Het
F5 C T 1: 164,193,328 T1124I possibly damaging Het
Fam220a T A 5: 143,563,471 C213S possibly damaging Het
Fat2 G T 11: 55,310,432 N605K probably damaging Het
Ganab C A 19: 8,914,569 S780* probably null Het
Gbgt1 C T 2: 28,502,207 P67S probably damaging Het
Gm17190 G T 13: 96,082,779 G208* probably null Het
Grhl2 A G 15: 37,291,616 Y316C probably damaging Het
H2-T10 T C 17: 36,120,849 T38A probably benign Het
Ins1 A G 19: 52,264,420 probably benign Het
Ippk T C 13: 49,432,467 probably null Het
Klc4 T A 17: 46,639,910 I258F probably benign Het
Manba C A 3: 135,542,393 L348I probably benign Het
Mgam A G 6: 40,744,789 N347S probably benign Het
Myo18b T C 5: 112,723,892 T2108A probably benign Het
Nsa2 C T 13: 97,131,220 A242T probably benign Het
Nsd2 G A 5: 33,882,147 W834* probably null Het
Olfr1134 T C 2: 87,656,396 N175S possibly damaging Het
Olfr1419 T A 19: 11,870,316 D300V possibly damaging Het
Olfr285 T C 15: 98,313,380 M57V probably damaging Het
Olfr469 A T 7: 107,822,922 C182* probably null Het
Pam A T 1: 97,842,247 D599E probably damaging Het
Phf20l1 A G 15: 66,636,884 K864R probably damaging Het
Plcl2 A G 17: 50,608,468 D835G probably damaging Het
Ppm1m C A 9: 106,196,157 A329S probably damaging Het
Prep T C 10: 45,150,438 V486A probably benign Het
Prkcb A T 7: 122,516,844 N182I probably damaging Het
Prkcz A G 4: 155,271,602 F355S probably damaging Het
Psg20 C T 7: 18,684,467 S125N probably benign Het
Psmd12 A G 11: 107,492,057 D234G probably benign Het
Pvrig A T 5: 138,342,008 M14L probably benign Het
Rabgap1l C T 1: 160,226,484 probably null Het
Rfc1 A T 5: 65,275,426 C764S probably damaging Het
Ryr3 T C 2: 112,926,957 D351G probably benign Het
Serpinb9g T C 13: 33,495,167 F340S probably benign Het
Sirpb1c C A 3: 15,832,266 L315F probably damaging Het
Slc24a1 C G 9: 64,928,404 E814Q unknown Het
Slc26a11 A T 11: 119,374,502 Q355L probably damaging Het
Sp100 C T 1: 85,707,239 L483F possibly damaging Het
St5 A G 7: 109,525,346 L1096P probably damaging Het
Ston1 T A 17: 88,635,901 M245K probably benign Het
Swap70 T A 7: 110,274,772 D442E probably benign Het
Syne2 T A 12: 76,046,186 V450D possibly damaging Het
Tbck T A 3: 132,752,563 N651K probably damaging Het
Timd4 A T 11: 46,817,758 T204S probably benign Het
Tmem102 A G 11: 69,804,885 L87P probably damaging Het
Tmem55a T A 4: 14,912,477 Y195* probably null Het
Tmprss11e T A 5: 86,709,480 T325S probably benign Het
Trpm1 G A 7: 64,240,582 V978M probably damaging Het
Wdr12 A T 1: 60,094,511 D19E probably benign Het
Wdr35 G A 12: 9,005,773 V482I probably benign Het
Wdr63 T C 3: 146,055,618 D661G probably benign Het
Zer1 T C 2: 30,101,484 probably null Het
Zfp503 T C 14: 21,986,011 D279G probably benign Het
Zfp870 A T 17: 32,883,762 C198S possibly damaging Het
Zfyve26 C T 12: 79,287,807 E146K probably benign Het
Zkscan6 T C 11: 65,828,531 V459A probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100223096 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGATGTCTGGTAGGGCTC -3'
(R):5'- TGGCTGGTGTCTCCTGAATC -3'

Sequencing Primer
(F):5'- GCTCTGGGTCGGATATTTTCATAG -3'
(R):5'- GCTGGTGTCTCCTGAATCTTCCTC -3'
Posted On2019-10-07