Mutagenetix > Incidental Mutation

Incidental Mutation 'R7466:Phf20l1'

578807

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R7466 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66636884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 864 (K864R)

Ref Sequence

ENSEMBL: ENSMUSP00000035682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]

AlphaFold

Q8CCJ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000048188
AA Change: K864R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: K864R

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000229160
AA Change: K863R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000229576

Predicted Effect

probably damaging
Transcript: ENSMUST00000230948
AA Change: K837R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (83/84)

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI182371	T	A	2: 35,088,741	K203*	probably null	Het
Akr1c13	T	C	13: 4,192,437		probably benign	Het
Amer3	A	G	1: 34,587,993	S438G	probably damaging	Het
Aqp9	T	A	9: 71,163,261		probably null	Het
Art4	G	T	6: 136,854,850	H98N	probably damaging	Het
Bdh1	T	C	16: 31,447,604	S70P	probably benign	Het
Ccdc61	A	C	7: 18,891,105	Y503D	probably damaging	Het
Cd163l1	T	C	7: 140,220,706		probably null	Het
Cd180	A	T	13: 102,704,995	N183I	probably damaging	Het
Cd200r2	C	T	16: 44,909,174	A64V	probably damaging	Het
Ceacam9	A	C	7: 16,723,855	K98Q	probably benign	Het
Cep44	AACGC	A	8: 56,540,983		probably null	Het
Cfap77	G	T	2: 28,955,613	D247E	probably benign	Het
Cftr	T	C	6: 18,227,973	M388T	probably benign	Het
Chrnb1	G	A	11: 69,784,650	H493Y	probably damaging	Het
Ckap2	A	C	8: 22,177,386	M153R	probably benign	Het
Cnot6l	A	G	5: 96,131,128	V77A	probably benign	Het
Col12a1	C	T	9: 79,655,407	E1798K	possibly damaging	Het
Cth	T	A	3: 157,924,885	D49V	probably benign	Het
Ctnnb1	T	C	9: 120,955,416	S425P	probably damaging	Het
Ctnnd1	T	C	2: 84,610,785	N690S	probably benign	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dennd4c	A	G	4: 86,774,331	D26G	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Eef2k	A	G	7: 120,903,484		probably null	Het
Ephb2	C	T	4: 136,659,065	R791H	probably damaging	Het
Erh	T	C	12: 80,640,983	Y22C	probably benign	Het
F5	C	T	1: 164,193,328	T1124I	possibly damaging	Het
Fam220a	T	A	5: 143,563,471	C213S	possibly damaging	Het
Fat2	G	T	11: 55,310,432	N605K	probably damaging	Het
Ganab	C	A	19: 8,914,569	S780*	probably null	Het
Gbgt1	C	T	2: 28,502,207	P67S	probably damaging	Het
Gm17190	G	T	13: 96,082,779	G208*	probably null	Het
Grhl2	A	G	15: 37,291,616	Y316C	probably damaging	Het
H2-T10	T	C	17: 36,120,849	T38A	probably benign	Het
Ins1	A	G	19: 52,264,420		probably benign	Het
Ippk	T	C	13: 49,432,467		probably null	Het
Klc4	T	A	17: 46,639,910	I258F	probably benign	Het
Manba	C	A	3: 135,542,393	L348I	probably benign	Het
Mgam	A	G	6: 40,744,789	N347S	probably benign	Het
Myo18b	T	C	5: 112,723,892	T2108A	probably benign	Het
Naip5	A	T	13: 100,221,986	L914*	probably null	Het
Nsa2	C	T	13: 97,131,220	A242T	probably benign	Het
Nsd2	G	A	5: 33,882,147	W834*	probably null	Het
Olfr1134	T	C	2: 87,656,396	N175S	possibly damaging	Het
Olfr1419	T	A	19: 11,870,316	D300V	possibly damaging	Het
Olfr285	T	C	15: 98,313,380	M57V	probably damaging	Het
Olfr469	A	T	7: 107,822,922	C182*	probably null	Het
Pam	A	T	1: 97,842,247	D599E	probably damaging	Het
Plcl2	A	G	17: 50,608,468	D835G	probably damaging	Het
Ppm1m	C	A	9: 106,196,157	A329S	probably damaging	Het
Prep	T	C	10: 45,150,438	V486A	probably benign	Het
Prkcb	A	T	7: 122,516,844	N182I	probably damaging	Het
Prkcz	A	G	4: 155,271,602	F355S	probably damaging	Het
Psg20	C	T	7: 18,684,467	S125N	probably benign	Het
Psmd12	A	G	11: 107,492,057	D234G	probably benign	Het
Pvrig	A	T	5: 138,342,008	M14L	probably benign	Het
Rabgap1l	C	T	1: 160,226,484		probably null	Het
Rfc1	A	T	5: 65,275,426	C764S	probably damaging	Het
Ryr3	T	C	2: 112,926,957	D351G	probably benign	Het
Serpinb9g	T	C	13: 33,495,167	F340S	probably benign	Het
Sirpb1c	C	A	3: 15,832,266	L315F	probably damaging	Het
Slc24a1	C	G	9: 64,928,404	E814Q	unknown	Het
Slc26a11	A	T	11: 119,374,502	Q355L	probably damaging	Het
Sp100	C	T	1: 85,707,239	L483F	possibly damaging	Het
St5	A	G	7: 109,525,346	L1096P	probably damaging	Het
Ston1	T	A	17: 88,635,901	M245K	probably benign	Het
Swap70	T	A	7: 110,274,772	D442E	probably benign	Het
Syne2	T	A	12: 76,046,186	V450D	possibly damaging	Het
Tbck	T	A	3: 132,752,563	N651K	probably damaging	Het
Timd4	A	T	11: 46,817,758	T204S	probably benign	Het
Tmem102	A	G	11: 69,804,885	L87P	probably damaging	Het
Tmem55a	T	A	4: 14,912,477	Y195*	probably null	Het
Tmprss11e	T	A	5: 86,709,480	T325S	probably benign	Het
Trpm1	G	A	7: 64,240,582	V978M	probably damaging	Het
Wdr12	A	T	1: 60,094,511	D19E	probably benign	Het
Wdr35	G	A	12: 9,005,773	V482I	probably benign	Het
Wdr63	T	C	3: 146,055,618	D661G	probably benign	Het
Zer1	T	C	2: 30,101,484		probably null	Het
Zfp503	T	C	14: 21,986,011	D279G	probably benign	Het
Zfp870	A	T	17: 32,883,762	C198S	possibly damaging	Het
Zfyve26	C	T	12: 79,287,807	E146K	probably benign	Het
Zkscan6	T	C	11: 65,828,531	V459A	probably damaging	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
acadia	UTSW	15	66636820	missense	possibly damaging	0.85
curt	UTSW	15	66639948	missense	possibly damaging	0.90
Cut	UTSW	15	66613039	nonsense	probably null
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
slang	UTSW	15	66641932	missense	probably benign	0.03
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
R8857:Phf20l1	UTSW	15	66641932	missense	probably benign	0.03
R9295:Phf20l1	UTSW	15	66641903	missense	probably damaging	1.00
R9393:Phf20l1	UTSW	15	66604106	missense	probably damaging	1.00
R9442:Phf20l1	UTSW	15	66613039	nonsense	probably null
R9522:Phf20l1	UTSW	15	66632820	missense	possibly damaging	0.89
R9727:Phf20l1	UTSW	15	66615382	missense	probably benign	0.01
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATCTCTGGGCTTATTCTGGGAAG -3'
(R):5'- TTAGGTATTAGCAAAGCCCAAGG -3'

Sequencing Primer
(F):5'- CTTATTCTGGGAAGAGGAAAGACC -3'
(R):5'- CTAGGTGTGTTTAATTCCATCAGC -3'

Posted On

2019-10-07