Incidental Mutation 'R7467:Kifap3'
ID578829
Institutional Source Beutler Lab
Gene Symbol Kifap3
Ensembl Gene ENSMUSG00000026585
Gene Namekinesin-associated protein 3
SynonymsSmg GDS, KAP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7467 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163779583-163917109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 163815833 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 209 (H209L)
Ref Sequence ENSEMBL: ENSMUSP00000027877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]
Predicted Effect probably benign
Transcript: ENSMUST00000027877
AA Change: H209L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: H209L

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077642
AA Change: H209L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: H209L

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,791,952 V153I probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 A G 7: 45,145,907 Y443H probably benign Het
Apbb1 A G 7: 105,566,132 V434A probably benign Het
Atrip A G 9: 109,069,354 M199T probably damaging Het
Atxn2 T C 5: 121,802,267 probably null Het
AU040320 A G 4: 126,814,310 T240A probably benign Het
Btf3l4 A T 4: 108,818,392 probably null Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Cdk15 G T 1: 59,289,779 W282L probably null Het
Cflar T A 1: 58,726,438 M1K probably null Het
Champ1 C A 8: 13,878,579 P246T possibly damaging Het
Crat A C 2: 30,409,982 F129V probably damaging Het
Csmd3 T C 15: 47,629,244 N2256S Het
Cwh43 C A 5: 73,411,968 Q118K probably damaging Het
Daam1 A T 12: 71,985,806 K949* probably null Het
Ddn C G 15: 98,805,366 E682Q possibly damaging Het
Des T A 1: 75,362,961 M321K possibly damaging Het
Dnm2 T C 9: 21,481,376 V460A probably damaging Het
Dst G A 1: 34,191,155 E2610K probably benign Het
Efr3a C T 15: 65,857,511 T660I possibly damaging Het
Eogt T C 6: 97,142,833 E138G probably benign Het
Epha8 G A 4: 136,931,088 A992V possibly damaging Het
Exoc2 A T 13: 30,925,733 D217E probably damaging Het
Fam222b T C 11: 78,154,347 S245P probably damaging Het
Fbxo45 T C 16: 32,238,521 Y185C probably damaging Het
Fbxo47 T C 11: 97,865,167 T170A probably benign Het
Fbxw26 A T 9: 109,732,697 V143E probably benign Het
Foxb2 T C 19: 16,873,640 M1V probably null Het
Gm11596 C A 11: 99,793,136 V53L unknown Het
Gm37596 T A 3: 93,692,958 T35S probably benign Het
Gm47791 A G 1: 82,770,826 *140Q probably null Het
Gpr179 C T 11: 97,335,289 M2013I probably benign Het
Hck T A 2: 153,129,930 L137* probably null Het
Hectd4 T A 5: 121,323,961 C964S possibly damaging Het
Hexa T C 9: 59,557,400 probably null Het
Ifna12 C A 4: 88,603,265 S15I possibly damaging Het
Kif18b C A 11: 102,916,408 V34L probably damaging Het
Kif18b A T 11: 102,912,348 probably null Het
Klhl1 A T 14: 96,123,277 D712E probably damaging Het
Kmt2c T C 5: 25,308,532 D3088G probably damaging Het
Mageb3 A G 2: 121,954,472 Y250H probably damaging Het
Manba G T 3: 135,544,801 E396D probably damaging Het
Mapkbp1 T A 2: 120,022,188 V997E probably damaging Het
Mdc1 A G 17: 35,844,556 H41R probably benign Het
Mis18a T G 16: 90,719,978 M179L probably benign Het
Mmp25 C G 17: 23,644,782 G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 P286S probably benign Het
Mrgpra2b G A 7: 47,464,529 H152Y possibly damaging Het
Mslnl A T 17: 25,736,921 M1L probably benign Het
Myo1d G A 11: 80,586,917 T880I probably damaging Het
Ncaph T A 2: 127,133,875 probably benign Het
Nln T C 13: 104,025,022 D680G possibly damaging Het
Noct C T 3: 51,225,201 A33V probably benign Het
Nolc1 A G 19: 46,082,334 T325A unknown Het
Nr2e3 A G 9: 59,949,151 probably null Het
Nrg2 T A 18: 36,022,406 H450L probably benign Het
Olfr1414 T A 1: 92,511,848 Y60F possibly damaging Het
Olfr1434 T A 19: 12,283,475 C142* probably null Het
Olfr224 A C 11: 58,566,462 N294K possibly damaging Het
Olfr532 T C 7: 140,419,374 N133S probably benign Het
Olfr994 T G 2: 85,430,827 M1L possibly damaging Het
Pank2 T A 2: 131,274,047 N128K possibly damaging Het
Pcdha3 T C 18: 36,947,531 V442A probably damaging Het
Pds5b T A 5: 150,736,327 S252T probably damaging Het
Pfpl T C 19: 12,428,514 L43S probably damaging Het
Pigu T A 2: 155,299,089 I295F probably damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Pls1 A G 9: 95,769,113 Y414H possibly damaging Het
Ppp1r13l A T 7: 19,371,380 Q359L probably damaging Het
Ppp2r5c A G 12: 110,552,883 Y263C probably damaging Het
Prrc2c A T 1: 162,677,363 S2638R possibly damaging Het
Prss39 T A 1: 34,499,392 probably null Het
Psmd1 G A 1: 86,116,633 V648M probably damaging Het
Rad50 T C 11: 53,654,908 D1196G probably damaging Het
Rfx1 T C 8: 84,073,913 Y48H possibly damaging Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rpl9 T C 5: 65,390,967 T9A probably benign Het
Samd4 A G 14: 47,087,856 N598D probably benign Het
Sema7a T C 9: 57,961,422 Y606H probably damaging Het
Sf3b3 A G 8: 110,811,456 S1150P possibly damaging Het
Sirt1 T C 10: 63,322,150 N495S probably benign Het
Slc17a3 T C 13: 23,846,967 probably null Het
Slc25a22 T C 7: 141,433,976 T24A probably benign Het
Slc30a9 T C 5: 67,345,644 I363T probably benign Het
Srbd1 A G 17: 86,099,274 V561A probably damaging Het
Srgap1 C A 10: 121,855,439 E297* probably null Het
Srgap2 T C 1: 131,292,667 S896G probably damaging Het
Sspo T C 6: 48,486,303 C3730R probably damaging Het
Stat2 T A 10: 128,277,903 probably null Het
Tcof1 T C 18: 60,831,905 K581E unknown Het
Thbs1 T C 2: 118,118,200 S446P probably damaging Het
Thsd7a T C 6: 12,331,585 Y1330C Het
Tmem121 C A 12: 113,189,070 P303T probably benign Het
Tmem87b T A 2: 128,849,151 probably null Het
Tmem98 A T 11: 80,820,185 probably null Het
Trpm3 T A 19: 22,978,334 I1091N possibly damaging Het
Urb2 A G 8: 124,028,511 E319G probably benign Het
Vmn1r170 A T 7: 23,606,895 M241L not run Het
Vmn1r238 T C 18: 3,123,393 N7S probably benign Het
Wdr6 T C 9: 108,573,002 H1109R probably benign Het
Zdhhc13 T C 7: 48,804,408 V193A probably benign Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp738 T A 13: 67,672,961 E89V probably benign Het
Zswim3 T A 2: 164,819,875 F92I possibly damaging Het
Other mutations in Kifap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Kifap3 APN 1 163797270 missense probably damaging 1.00
IGL01655:Kifap3 APN 1 163796049 splice site probably benign
IGL02385:Kifap3 APN 1 163865444 nonsense probably null
IGL02517:Kifap3 APN 1 163825871 splice site probably benign
IGL02756:Kifap3 APN 1 163862028 missense probably damaging 0.98
IGL03034:Kifap3 APN 1 163888277 missense probably benign 0.05
IGL03230:Kifap3 APN 1 163825724 missense probably benign 0.02
IGL03270:Kifap3 APN 1 163848733 missense probably benign 0.18
IGL03340:Kifap3 APN 1 163829149 missense possibly damaging 0.94
R0207:Kifap3 UTSW 1 163883386 missense probably benign 0.00
R0333:Kifap3 UTSW 1 163797264 missense probably damaging 1.00
R0426:Kifap3 UTSW 1 163865552 splice site probably benign
R1467:Kifap3 UTSW 1 163829120 splice site probably benign
R1482:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R1547:Kifap3 UTSW 1 163794086 missense probably benign 0.01
R1704:Kifap3 UTSW 1 163829196 missense possibly damaging 0.50
R1724:Kifap3 UTSW 1 163783097 nonsense probably null
R1982:Kifap3 UTSW 1 163862022 nonsense probably null
R2233:Kifap3 UTSW 1 163856065 missense probably benign
R2273:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2274:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2275:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R3420:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3421:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3422:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R4194:Kifap3 UTSW 1 163915825 missense probably benign 0.10
R4260:Kifap3 UTSW 1 163862028 missense probably damaging 0.98
R4464:Kifap3 UTSW 1 163817895 missense probably benign 0.00
R4635:Kifap3 UTSW 1 163814435 missense probably damaging 1.00
R5090:Kifap3 UTSW 1 163856076 missense possibly damaging 0.89
R5426:Kifap3 UTSW 1 163779871 start codon destroyed probably null 0.30
R5868:Kifap3 UTSW 1 163865472 missense probably damaging 1.00
R6107:Kifap3 UTSW 1 163868769 missense possibly damaging 0.50
R6437:Kifap3 UTSW 1 163857526 missense probably damaging 0.99
R6744:Kifap3 UTSW 1 163848670 missense probably benign 0.00
R7051:Kifap3 UTSW 1 163794080 missense probably damaging 1.00
R7143:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R7143:Kifap3 UTSW 1 163856040 missense possibly damaging 0.66
R7216:Kifap3 UTSW 1 163795989 missense probably damaging 0.98
R7564:Kifap3 UTSW 1 163915768 missense probably damaging 1.00
U24488:Kifap3 UTSW 1 163783035 missense possibly damaging 0.64
Z1177:Kifap3 UTSW 1 163862062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACGGGCAGAATGTTAACAC -3'
(R):5'- GACACATTCTTGCATGGTTTCC -3'

Sequencing Primer
(F):5'- CTGTGGTTATATTCATACACTAGAA -3'
(R):5'- GAGAGAACAAGCCCACCCTAC -3'
Posted On2019-10-07